OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Vti1a (NM_016862) Mouse Untagged Clone

Be the first to review this product
SKU
MC203914
Vti1a (untagged) - Mouse vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (Vti1a), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Vti1a or NM_016862"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Vti1a
Synonyms 1110014F16Rik; 1110018K19Rik; 4921537J05Rik; MVti1; MVti1a; Vti1; Vti1-rp2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC019386
CTTCCCTCGGAAAGCCCGCGCCTGCAACTTAGAGTTTGGGGGCGCTCCAGCCGTTTCTCTGGAGCTGCAG TGTGGGGGACGTGTATTCTGTGATACCCGAGAGCATGTGGGCTTTCGTAGTCTTTTTTTTTTTTTTTAGG GGTCACCGAAAGTGAACTTTTTCTTTAGTTTTACGTTCGAAGATTTGGGTGGAAAGGAAAAGGCGCAGGC AGCGTAGTTTCCGGAGGACAAGGACTACGTAGAGCAACCAGGAAGCGGCAGGGCTGGGAGTTGTTCCCGG TTCCCGCTGTGCTGTGGAGACTTCTTCACAGGGTCCCTGCGCCGAGGCCGGGCGCCCTTGGCGAGTCCCG CTCTGAGCGCTAGAACCCGGCTCCGGCCGGCCGTGCCCGAGCTGCCATGTCTTCCGACTTCGAAGGGTAC GAGCAGGACTTCGCAGTGCTCACTGCTGAGATCACCAGCAAGATTGCAAGGGTCCCTCGGCTCCCTCCCG ATGAGAAGAAGCAAATGGTTGCCAATGTGGAGAAACAGCTTGAAGAGGCCAGAGAACTGCTTGAACAGAT GGATTTGGAAGTTCGAGAAATTCCACCCCAAAGTCGAGGAATGTATAGCAACAGGATGAGAAGCTACAAG CAAGAAATGGGGAAACTGGAAACGGATTTTAAAAGGTCACGGATTGCCTACAGTGACGAAGTACGGAATG AGCTCCTAGGGGATGCTGGGAATTCCTCCGAGAACCAGAGGGCACATCTGCTGGATAACACGGAGAGGCT GGAAAGGTCGTCTCGGAGACTAGAGGCTGGGTACCAGATAGCAGTGGAGACCGAGCAAATCGGCCAAGAG ATGTTGGAAAACCTGAGTCATGACAGAGAAAAGATACAGCGGGCACGTGACCGACTCCGGGACGCAGACG CAAACCTGGGGAAGAGCTCTCGGATTCTGACGGGGATGCTGCGAAGAATCATCCAGAACCGTATCCTGCT CGTCATCTTGGGGATCATCGTGGTCATCGCCATCCTGACGGCCATCGCGTTTTTCGTCAAAGGACACTGA TGCATCTGGTCCCCCTTGATAAACAGTGATCTTGGCTTGTTCCGAGTAATTAAGACAAAAAAAAAAAAAA AA
Restriction Sites RsrII-NotI |
ACCN NM_016862
Insert Size 654 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC019386, AAH19386
RefSeq Size 1122 bp
RefSeq ORF 654 bp
Locus ID 53611
UniProt ID O89116
Cytogenetics 19 D2
Summary V-SNARE that mediates vesicle transport pathways through interactions with t-SNAREs on the target membrane. These interactions are proposed to mediate aspects of the specificity of vesicle trafficking and to promote fusion of the lipid bilayers. Involved in vesicular transport from the late endosomes to the trans-Golgi network. Along with VAMP7, involved in an non-conventional RAB1-dependent traffic route to the cell surface used by KCNIP1 and KCND2. May be concerned with increased secretion of cytokines associated with cellular senescence.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_016862" in other vectors (4)
SKU Description Size Price
MG202429 Vti1a (tGFP-tagged) - Mouse vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (Vti1a) 10 ug
$500.00
MR202429 Vti1a (Myc-DDK-tagged) - Mouse vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (Vti1a) 10 ug
$289.00 $300.00
MR202429L3 Lenti ORF clone of Vti1a (Myc-DDK-tagged) - Mouse vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (Vti1a) 10 ug
$600.00
MR202429L4 Lenti ORF clone of Vti1a (mGFP-tagged) - Mouse vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (Vti1a) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products