Ubl4a (NM_145405) Mouse Untagged Clone
CAT#: MC203830
Ubl4 (untagged) - Mouse ubiquitin-like 4 (Ubl4), (10ug)
"NM_145405" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Ubl4a |
Synonyms | DXHXS254E; DXS254E; DXS254Eh; Gdx; Ubl4 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC010817
GGCGGCGCGCGGCAGGGGACCGTTGGTGTTTGCGTTGGCCGTAGTGGACTGGGCCGTGGACACCATGCAG CTGACCGTGAAGGCGCTCCAGGGCCGGGAATGTAGCCTACAGGTGGCGGAGGACGAGCTAGTGTCTACAC TGAAGCACCTGGTCTCGGATAAGCTGAATGTCCCTGTGCGCCAGCAACGTCTGCTGTTCAAGGGCAAGGC CCTAGCAGATGAAAAACGACTGTCAGATTACAACATTGGGCCCAATTCTAAGCTCAACCTAGTTGTTAAG CCTTTGGAGAAGGTGCTACTGGAAGAAGGGTCTGCCCACAGACTGGTCGACTCCCCAGCCACCCCCATCT GGCAGCTGATCTCCAAAGTCCTGGCCCGTCACTTCAGTGTAGCAGATGCCAGCAGGGTCCTGGAACAACT ACAGAGGGATTATGACAGGTCCTTGAGCCGCCTAACACTGGATGACATCGAACGTTTGGCCAGCCGCTTT CTACACCCTGAAGTGACTGAGGCTATGGAAAAAGGGTTCTGCAAATAGCATTCTGGGATTGTGGGGAGAA ATCCCAGGTCAGGCCACAGCTGCATGTTGCATTAAATGTGTTCTCATGTCGCAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_145405 |
Insert Size | 474 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC010817, AAH10817 |
RefSeq Size | 629 bp |
RefSeq ORF | 474 bp |
Locus ID | 27643 |
UniProt ID | P21126 |
Cytogenetics | X 38.0 cM |
Gene Summary | As part of a cytosolic protein quality control complex, the BAG6/BAT3 complex, maintains misfolded and hydrophobic patches-containing proteins in a soluble state and participates to their proper delivery to the endoplasmic reticulum or alternatively can promote their sorting to the proteasome where they undergo degradation. The BAG6/BAT3 complex is involved in the post-translational delivery of tail-anchored/type II transmembrane proteins to the endoplasmic reticulum membrane. Recruited to ribosomes, it interacts with the transmembrane region of newly synthesized tail-anchored proteins and together with SGTA and ASNA1 mediates their delivery to the endoplasmic reticulum. Client proteins that cannot be properly delivered to the endoplasmic reticulum are ubiquitinated and sorted to the proteasome. Similarly, the BAG6/BAT3 complex also functions as a sorting platform for proteins of the secretory pathway that are mislocalized to the cytosol either delivering them to the proteasome for degradation or to the endoplasmic reticulum. The BAG6/BAT3 complex also plays a role in the endoplasmic reticulum-associated degradation (ERAD), a quality control mechanism that eliminates unwanted proteins of the endoplasmic reticulum through their retrotranslocation to the cytosol and their targeting to the proteasome. It maintains these retrotranslocated proteins in an unfolded yet soluble state condition in the cytosol to ensure their proper delivery to the proteasome.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer, protein-coding transcript. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201186 | Ubl4 (tGFP-tagged) - Mouse ubiquitin-like 4 (Ubl4) |
USD 350.00 |
|
MR201186 | Ubl4 (Myc-DDK-tagged) - Mouse ubiquitin-like 4 (Ubl4) |
USD 150.00 |
|
MR201186L3 | Lenti ORF clone of Ubl4 (Myc-DDK-tagged) - Mouse ubiquitin-like 4 (Ubl4) |
USD 450.00 |
|
MR201186L4 | Lenti ORF clone of Ubl4 (mGFP-tagged) - Mouse ubiquitin-like 4 (Ubl4) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review