Ints11 (NM_028020) Mouse Untagged Clone

CAT#: MC203818

Cpsf3l (untagged) - Mouse cleavage and polyadenylation specific factor 3-like (Cpsf3l), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ints11 (NM_028020) Mouse Untagged Clone
Symbol Ints11
Synonyms 2410006F12Rik; AU044035; Cpsf3l
Vector pCMV6-Kan/Neo
Sequence Data
>BC011155
CTCGCCGCGGCCGGGCGTCTGATGTGAGCGCGCGCGGGGTCTGCCTGCGGCTCTCCTGCGGGCGGTGCAC GCGAGCCGTGGAGCCGTGGTTCGAGGCGACCTCCCTCACCATGCCCGAGATTAGGGTCACTCCCTTGGGG GCTGGCCAGGATGTAGGCCGAAGCTGCATCTTGGTCTCCATTTCGGGGAAGAATGTCATGTTGGACTGTG GGATGCACATGGGCTACAATGATGACAGGCGCTTTCCTGACTTTTCTTACATCACCCAGAGTGGCCGCCT GACTGACTTTCTGGACTGTGTGATCATCAGCCACTTCCACCTGGACCATTGTGGGGCACTCCCCTACTTC AGTGAAATGGTGGGCTACGATGGACCCATCTATATGACCCATCCTACCCAGGCCATCTGCCCCATCCTGT TGGAAGACTACCGCAAGATTGCAGTGGACAAGAAGGGCGAGGCCAATTTCTTCACTTCTCAGATGATCAA AGACTGTATGAAGAAGGTGGTGGCTGATCACCTGCACCAGACAGTTCAGGTGGATGATGAGCTGGAAATC AAGGCATACTATGCAGGCCACGTGCTGGGGGCAGCCATGTTCCAGATTAAAGTGGGCTCGGAGTCTGTGG TCTACACGGGTGACTATAACATGACCCCAGACCGGCATTTGGGGGCTGCGTGGATTGACAAGTGTCGCCC CAACTTGCTCATCACAGAATCCACATATGCTACAACCATCCGAGATTCCAAACGCTGCAGAGAGCGAGAT TTCCTAAAGAAAGTTCATGAAACTGTGGAGCGTGGAGGAAAGGTGCTGATTCCTGTGTTTGCGCTGGGCC GAGCACAAGAACTCTGCATCCTGCTGGAGACCTTCTGGGAGCGCATGAACCTGAAGGTGCCCATATACTT CTCTACGGGCCTGACAGAGAAAGCCAACCACTACTACAAGCTCTTCATCACCTGGACCAACCAGAAGATC CGGAAGACGTTCGTCCAGAGGAACATGTTTGAGTTTAAGCACATCAAAGCCTTTGACCGGACATTTGCTG ACAACCCAGGTCCCATGGTTGTGTTTGCCACACCTGGGATGCTGCATGCTGGCCAATCCCTGCAAATCTT CCGGAAGTGGGCAGGAAATGAGAAGAACATGGTCATCATGCCTGGTTATTGTGTGCAAGGCACCGTGGGC CACAAGATCCTTAGTGGGCAACGTAAACTGGAAATGGAAGGGCGCCAGATGCTGGAGGTAAAGATGCAAG TGGAATACATGTCCTTCAGCGCCCATGCTGATGCCAAGGGCATCATGCAGCTGGTAGGACAAGCGGAGCC CGAGAGTGTGCTGTTGGTGCATGGCGAAGCCAAGAAGATGGAGTTCCTGAGGCAGAAGATTGAGCAGGAA TTCCGGGTCAGCTGCTACATGCCGGCCAATGGTGAGACAGTGACGCTGCCCACAAGCCCTAGCATCCCTG TGGGCATCTCCCTGGGATTGCTGAAGCGGGAGATGGTGCAGGGGCTGTTGCCTGAAGCCAAAAAACCTAG GCTTTTACATGGCACCCTCATTATGAAAGACAGTAATTTCCGGCTGGTATCCTCAGAGCAAGCCCTGAAG GAGCTGGGCCTGGCAGAGCACCAACTTCGCTTCACCTGTCGTGTGCACCTGCAGGACACACGCAAAGAAC AAGAAACAGCTTTACGTGTGTACAGCCATCTCAAGAGCACCCTCAAGGACCACTGTGTACAGCATCTCCC CGATGGCTCTGTGACTGTGGAGTCCATTCTAATCCAGGCTGCCGCCCATTCGGAGGACCCTGGTACCAAG GTGCTATTGGTCTCCTGGACTTACCAGGATGAAGAGCTGGGAAGCTTCCTCACAACATTGCTCAAAAATG GCCTTCCTCAGGCTCCCAGCTGACATGTATCCACCAGGAATCCACTGCTCTTGTCTCTTGCTGTTCTCCC AGCAGGACCAGGGCTTCGGCCGAGAGGCGGGTGCCCTGAGTAAATGGGAGGCCATGACTGGATTACAGAC CCCGTTCTAGGGATAAGATCAGAGTCATAGGCTGGCTAAAGTAATAAACAGACCTTTTTGTTCTCTAAAA AAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_028020
ORF Size 1803 bp
Insert Size 1803
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC011155, NP_082296
RefSeq Size 2112
RefSeq ORF 1803
Locus ID 71957
Cytogenetics 4 E2|4 87.66 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.