OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Arfrp1 (NM_029702) Mouse Untagged Clone

Be the first to review this product
SKU
MC203697
Arfrp1 (untagged) - Mouse ADP-ribosylation factor related protein 1 (Arfrp1), transcript variant 2, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Arfrp1 or NM_029702"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Arfrp1
Synonyms 1500006I01Rik; AI480700
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC010713
CCCATGCGTCCGGCTCCGTCCTTCGCTCCTTGTTCCGTCAGGCACTGTGAGGGGTCAGCGTGAGGTCGGT GGGGTTAGGAACGCGGCGGCGGCGGCGGCGGCGGCGGCGGCTCCTCCTCCAAGATCTGAGCAGGGTGCCA GAACAGGATGTACACGCTGCTTTCGGGATTGTACAAGTACATGTTCCAGAAGGATGAATACTGCATCCTG ATCCTGGGCCTGGACAATGCTGGGAAGACGACTTTCCTGGAACAGTCAAAAACACGCTTTAACAAGAACT ACAAGGGGATGAGTCTATCCAAAATCACCACTACCGTGGGTCTAAACATTGGCACTGTGGACGTGGGAAA GGCTCGTCTCATGTTTTGGGACTTAGGTGGGCAGGAAGAGCTGCAGTCTTTGTGGGACAAGTACTATGCA GAGTGCCATGGTGTCATCTATGTAATTGATTCCACTGATGAAGAAAGGCTGTCAGAATCAAAAGAGGCAT TTGAGAAGGTGGTTTCGAGTGAAGCACTGGACGGTGTTCCCATCCTGGTGTTGGCCAACAAGCAGGATGT GGAGACTTGCCTCTCCATTCCTGACATCAAGACTGCATTCAGTGACTGTACCTGTAAGATTGGCCGGCGA GATTGTCTGACCCAGGCCTGCTCTGCCCTCACAGGCAAAGGAGTTCGAGAGGGCATCGAATGGATGGTGA AGTGTGTCGTGCGGAATGTTCACCGGCCACCACGGCAGAGGGACATCACATAAGGACCTCCAACCTCAGT CTTGGACTGTTCGTCTCCTAGTGTTGGAAGAGTATTCTCTGCTGGCTTCTATCCTACTGACACTGGGGGT TGAGCTGCCTTTGTCTGTTCATTCTTTTATTTGCTTTATGTTTTCTCTAAGACAAACTTTTCTCTGTGTC TGGAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_029702
Insert Size 606 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC010713, AAH10713
RefSeq Size 934 bp
RefSeq ORF 606 bp
Locus ID 76688
UniProt ID Q8BXL7
Cytogenetics 2 H4
Summary The gene encodes a membrane-associated GTPase that is related to the ADP-ribosylation factor (ARF) and ARF-like (ARL) genes. It plays an essential role in Golgi function controlling recruitment of GRIP domain proteins and ARL1 to the trans-Golgi and trans-Golgi to plasma membrane trafficking of cell surface proteins such as E-cadherin. Deletion of this gene in mice leads to embryonic lethality during early gastrulation, which is at least partly caused by the disruption of E-cadherin trafficking to the cell surface and therefore lack of sufficient cell-cell adhesion in the embryo. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Oct 2009
Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_029702" in other vectors (4)
SKU Description Size Price
MG222074 Arfrp1 (tGFP-tagged) - Mouse ADP-ribosylation factor related protein 1 (Arfrp1) transcript variant 2, (10ug) 10 ug
$530.00
MR222074 Arfrp1 (Myc-DDK-tagged) - Mouse ADP-ribosylation factor related protein 1 (Arfrp1), transcript variant 2 10 ug
$330.00
MR222074L3 Lenti ORF clone of Arfrp1 (Myc-DDK-tagged) - Mouse ADP-ribosylation factor related protein 1 (Arfrp1), transcript variant 2 10 ug
$630.00
MR222074L4 Lenti ORF clone of Arfrp1 (mGFP-tagged) - Mouse ADP-ribosylation factor related protein 1 (Arfrp1), transcript variant 2 10 ug
$630.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products