Shkbp1 (NM_138676) Mouse Untagged Clone

CAT#: MC203620

Reviews ()
Write a review

Shkbp1 (untagged) - Mouse Sh3kbp1 binding protein 1 (Shkbp1), (10ug)



  "NM_138676" in other vectors (4)

USD 220.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Shkbp1 (NM_138676) Mouse Untagged Clone
Type Mouse Untagged Clone
Tag Tag Free
Symbol Shkbp1
Synonyms B930062H15Rik; Sb1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>BC061477
GGGCTATGGCCGTCGCGACGACTGCAGTGGAGGGGGTCCCGAGTCGGGGAGCACCCGGGGAAGTGATTCA TCTGAACGTAGGGGGCAAGCGGTTCAGTACCTCTCGCCAGACGCTTACCTGGATCCCAGACTCCTTCTTT TCCAGTCTTTTGAGCGGACGCATCTCAACCCTGAAAGATGAGACCGGAGCTATCTTCATCGACCGGGACC CCACCGTCTTTGCCCCCATCCTTAATTTCCTGCGGACCAAAGAGTTAGATCCCAGGGGTGTCCATGGTTC CAGCCTCCTCCATGAAGCCCAATTCTACGGACTCACTCCACTGGTTCGTCGCCTGCAGGTGAGGGAAGAG TTGGATCGATCTTCCTGCGGAAATGTCCTCTTCAATGGTTATCTACCTCCTCCAGTGTTCCCAGTGAAGC GGCGAAACCGGCACAGCCTGGTGGGGCCCCAGCAAATAGGGGGACGCCCAGCCCCTGTTCGACGGAGCAA CACGATGCCCCCCAACTTGGGTAATGCAGGGCTGCTGGGCCGAATGTTAGATGAGAGAGCACCTCCATCC CCATCAGGCCAACCAGAGGAGCCAGGGATGGTGCGCCTGGTGTGTGGTCACCACAACTGGATTGCTGTGG CATATACCCACTTTCTCGTCTGTTATAGGTTGAAGGAAGCCTCGGGCTGGCAGCTTGCATTCTCCAGCCC GCGCCTGGACTGGCCCATCGAGCGCCTGGCTCTTGCGGCTCGGGTGCTTGGCGGTGCTCCGGGTGAGCAT GACAAGATGGTGGCTGCAGCTACTGGCAGCGAGATCCTTCTGTGGGCCCTACAAGCACAAGGTGGTGGCT CTGAGATAGGTGTCTTCCACCTGGGTGTGCCAGTGGAGGCCTTGTTCTTTGTTGGGAATCAGCTCATTGC CACAAGTCACACAGGGCGCATCGGTGTCTGGAACGCTGTGACCAAGCACTGGCAGGTCCAGGAGGTCCAG CCTATCACGAGCTATGATGCAGCCGGCTCCTTCCTCCTCCTGGGCTGCAGCAATGGCTCCATCTATTATG TAGATGTGCAGAAATTCCCCCTGCGGATGAAGGACAACGATCTCCTTGTCAGTGAGCTCTACCGAGACCC AGCAGAGGATGGGGTCACCGCCCTCAGCGTCTACCTCACCCCCAAGACCAGTGACAGTGGGAACTGGATT GAGATTGCCTATGGCACCAGCTCCGGGGTGGTGCGGGTCATTGTGCAGCACCCTGAGACGGTGGGCTCGG GACCCCAGCTCTTCCAGACCTTCAGTGTGCACCGCAGCCCGGTCACTAAGATCATGCTGTCAGAGAAGCA TCTTATCTCTGTGTGTGCCGACAACAACCATGTTCGGACGTGGTCTGTGACCCGCTTTCGAGGCATGATC TCCACCCAGCCTGGTTCCACTCCGCTGGCATCCTTCAAGATCCTGGCGCTGGAATCTGTTGATGGGCTCG GTGGCTGCAGTGCTGGCAATGACATTGGTCCCTATGGTGAACGGGATGACCAGCAGGTGTTCATCCAGAA AGTGGTGCCAAATGCCAGTCAGCTATTTGTGCGTCTCTCTTCCACTGGGCAGCGGGTGTGTTCTGTGCGC TCGGTGGATGGGTCTCCCACGACTGCCTTCACAGTGTTGGAGTGTGAGGGCTCCAGGCGGCTGGGCTCCA GACCCCGACGTTACCTGCTCACTGGTCAGGCCAACGGCAGCCTGGCCATGTGGGACCTGACCACTGCCAT GGATGGCCTGGGCCAAACTCCTGCAGGCGGCCTGACAGAAGAAGAGCTGATGGACCAACTGGAGCAATGT GAGCTGAGCCCATTGGCTTCCTCTCGGGGCTCTTTCCCCAGCCCCTCACCCAGGACCTCTCTTACCAGTC TCCACTCAGCCTCCAGCAACACCTCCCTGTATGGCCCCAGAGGGAGCCCCAGCCCACCACAGGCAGAGGC CCGTCGCCGCGGGGCAGGAAGCTTCGTGGATCGGTGTCAGGAACTGGCAAGGGGTGCGCCAGAGCTCAGA TGGCCGCCAACACCAGCCCCTCGACCCTCCACCAGTCTTGGGAATCCCCTGACAGCTCTCAAGAAAACTC TTAACGAAACTTCCTTTTGAATCTAGCCACCAATGTGCCTTCATGTGGACTGGTCCCAGGGGACTTGGAA CTGGGGAGGGGGCTTCCTGTTGGAGCCAGGGCCAGGGGCTCCTTGGTGTAATCTGTGTCGCCAGGTTCCC ACCTCTCTCCTTTTCTAAAAGCCAAAGCCACTATCTCCAATAAAACCGTCACTGCCAACAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_138676
Insert Size 2115 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC061477, AAH61477
RefSeq Size 2409 bp
RefSeq ORF 2115 bp
Locus ID 192192
Cytogenetics 7 A3
Gene Summary Inhibits CBL-SH3KBP1 complex mediated down-regulation of EGFR signaling by sequestration of SH3KBP1. Binds to SH3KBP1 and prevents its interaction with CBL and inhibits translocation of SH3KBP1 to EGFR containing vesicles upon EGF stimulation (PubMed:21830225).[UniProtKB/Swiss-Prot Function]

Other Versions

Other products for "Shkbp1"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools