Il11ra1 (NM_010549) Mouse Untagged Clone

CAT#: MC203571

Il11ra1 (untagged) - Mouse interleukin 11 receptor, alpha chain 1 (Il11ra1), transcript variant 1, (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Il11ra1 (NM_010549) Mouse Untagged Clone
Symbol Il11ra1
Synonyms AI314697; GP130; Il-11ra; Il11ra; Il11ra2; NR1
Vector pCMV6-Kan/Neo
Sequence Data
>BC057664
GAAGTCTTGGAGGCCATGGGCACTCAGTCACTGTGATTATCAAGATGAGCAGCAGCTGCTCAGGGCTGAC CAGGGTCCTGGTGGCCGTGGCTACAGCCCTGGTGTCTTCCTCCTCCCCCTGCCCCCAAGCTTGGGGTCCT CCAGGGGTCCAGTATGGACAACCTGGCAGGCCCGTGATGCTGTGCTGCCCCGGAGTGAGTGCTGGGACTC CAGTGTCCTGGTTTCGGGATGGAGATTCAAGGCTGCTCCAGGGACCTGACTCTGGGTTAGGACACAGACT GGTCTTAGCCCAGGTGGACAGCCCTGATGAAGGCACTTATATCTGCCAGACCCTGGATGGTGTATCAGGG GGCATGGTGACCCTGAAGCTGGGCTTTCCCCCAGCACGTCCTGAGGTCTCCTGCCAAGCGGTAGACTATG AAAACTTCTCCTGTACTTGGAGTCCAGGCCAGGTCAGCGGTTTGCCCACCCGCTACCTTACTTCCTACAG GAAGAAGACGCTGCCAGGAGCTGAGAGTCAGAGGGAAAGTCCATCCACTGGGCCTTGGCCGTGTCCACAG GACCCTCTGGAGGCCTCCCGATGTGTGGTCCATGGGGCAGAGTTCTGGAGTGAGTACCGGATCAATGTGA CCGAGGTGAACCCACTGGGTGCCAGCACGTGCCTACTGGATGTGAGATTACAGAGCATCTTGCGTCCCGA TCCACCCCAAGGACTGCGGGTGGAATCGGTACCTGGTTACCCGAGACGCCTGCATGCCAGCTGGACATAC CCTGCCTCCTGGCGTCGCCAACCCCACTTTCTGCTCAAGTTCCGGTTGCAATACCGACCAGCACAGCATC CAGCCTGGTCCACGGTGGAGCCCATTGGCTTGGAGGAAGTGATAACAGATGCTGTGGCTGGGCTGCCACA CGCGGTACGAGTCAGTGCCAGGGACTTTCTGGATGCTGGCACCTGGAGCGCCTGGAGCCCAGAGGCCTGG GGTACTCCTAGCACTGGTCCCCTGCAGGATGAGATACCTGATTGGAGCCAGGGACACAGACAGCAGCTAG AGGCAGTAGTAGCTCAGGAGGACAGCCCGGCTCCTGCAAGGCCTTCCTTGCAGCCGGACCCAAGGCCACT TGATCACAGGGACCCCTTGGAGCAAATAGCTGTGTTAGCGTCTCTGGGAATCTTCTCTTGCCTTGGCCTG GCTGTTGGAGCCCTGGCACTGGGGCTCTGGCTGAGGCTGAGACGGAGTGGGAAGGATGGACCGCAAAAAC CTGGGCTCTTGGCACCCATGATCCCGGTGGAAAAGCTTCCAGGAATTCCAAACCTGCAGAGGACCCCAGA GAACTTCAGCTGATTTCATCTGTAACCCGGTCAGACTTGGGTGGTTAAAAGGACAGGCAGAAAGAGGCGG GGCAGTGGATCCCTGTGGATGGAGGTCTCAGCTGGAAGTCTGAGCTCTTTTCTTTGACACCTATACTCCA AACTTGCTGCCGGCTGAAGGCTGTCTGGACTTCTGATGTCCTGAGGTGGAAGTCCACCTGAGGAATGTGT ACAGAAGTCTGTGTTCCTGTGATCGTGTGTGTATGTGAGACAGGGAGCAAAAGTTCTCTGCATGTGTGTA CAGATGATTGGAGAGTGTGTGCGGTCTTGGGCTTGGCCCTTCTGGGGAGTGTGAAGAGTTGAAATAAAAG AGACGGAAGTTTTTGGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_010549
ORF Size 1299 bp
Insert Size 1299
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC057664, NP_034679
RefSeq Size 1800
RefSeq ORF 1299
Locus ID 16157
Cytogenetics 4 A5|4 21.94 cM
Gene Summary A soluble form (sIL11RA) can act as an antagonist of IL11-dependent cell differentiation in cells where both transmembrane IL11RA and IL6ST are present. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.