Mslnl (NM_177822) Mouse Untagged Clone

CAT#: MC203351

Mslnl (untagged) - Mouse mesothelin-like (Mslnl), (10ug)

  View "NM_177822" in other vectors (6)

USD 200.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Mslnl (NM_177822) Mouse Untagged Clone
Symbol Mslnl
Synonyms 4732467B22
Vector pCMV6-Kan/Neo
Sequence Data
>BC052484
CTGGACCTACAACCCACAGCCTTCGGGCTTCCCTGCTTTGAGACATTTCAGCCAGGATGAGCAGAACTCT CCGACCGTCAGCTATGGGTTCCAGAGTGGGTGCCCTGGCAAGTCCTGGTCTCGCCCTCCTCCTGTCCCTC ACCGCCCACTGCTCGGGTCCTCAGGCTAAAGGCTTGCCCAAGGGAGGACTGAATGCAAGTGAAGCCAACA CATGGGTCAGGAACAACACCTCCCTCCTGCAAAACTTCTGGTGCTTGCCAGCCAGCCAGCTGCCCCGAGA ACAGCTCTCCAGTTTAATCAGAAGCCTGGCTTCACAGAGGGTTGCACTCAAAGCCTGGCAGCTCAGCTGC TTGGCCAACCTCGCTGCACAGCTGGGTCTCCAGGATGACTTCGAATTCCACCCACCCAACCTTCTACTTT TCTACGATCTGAGCCAGGTGGGGGACACTAACTGCCGGGCCTTCATTCACCATGCTGCCCAAGGGGACAC AGAACTGCTCACCAACTTGCCCAACCAGAGAGTTGCCCTGCAGCGCACAGCCTTGGCCTGTCTGGGCGGA CCCCACCTACAGCTCAGTGCTTCAGACCTGTGGCTTCTTGGGGTCCTGGTGTGTGACATGGAGGCAGCAC AAATTGTGACTGCAGACCCCAGTGTGCTGAGGAACCTGCTTCGCTGCCCAAGGCTTACTGTCATGCAGAC TGCGGCCCTTAACACCCTGCTGGCCAGTGGGAAGACGCAAATCGGGCCTCCTGGCTCCTGGAACCTGCAG GGGCTACAGGCCCTCGGACTTCTGGCCACTTACATCAGCCCCCACCTGTGGGAGAAGGTGCAGGAGGCTG TGGGCTTGGACTTCTTCCGCAGTGTGGTGGCTGCTTGCCGGGCAGGCCAACTGAGCAGGCACGATGCCAG ACGCTTCGTTGACAACTTCCTAGAGTCCAAGGCCACTTCAGTGTCCTCAAGGCCCAAGCGGCGCACAGGG AGATCCTGTGTCCGTGGCAACATCACAGCAGCCACCCTGCACGATGACCTCTTCCTGGTGCACTATGACT GCACCCAGCTGGAATCCTGCCTAGGCACACGCGTGCTCAGGGCCAACCTGGACCCCTTGCTCCAACACCC GCTGCCTGCAGAGTGCCAGCGCGTTGTCAAAGCCAAGCTTACTCAGATTTACCCACATGGCATCCCTGAG GACCAGCTGCACCTCATCCCCTCGCTGGTCTACCTCTACTCCCTCGCTGAAATAGGCCAGTGGAACATCA CATCCGGGGACACAGTGATGATCCTGCTGGCCTCAGATGCGGCTCTGGACAACCAGACGGAGGCAGTTCT ACAGAGGTTCTTGGACCACAATGGCAAGGTCACTGGAGCTCTTCTGGTGGCCATCGGGGGTTCCCGTCTC TGCTGGATGAGCCTCAAGCAGCTTCAGTTTATCCAGCCCTCAGAGTTCCGGCTGGCCGGAGCTCCAGACA TCTCTCCCTGCCCCCAGAGTCGGAAGGATGCGCTCTTTGTCAAGGCTCATGAGGTCTTTAGGAACACCAG TAATGTGGGAGAATATTACTACTTAATCCGCCCCTACCTCGGTGGTGCCCCTTTGGAGGAACTTCAATAC CTGGCACAGGCCAACATCTCCATGGACATTGACACGTTCACCAACCTCAACCCCCTGACACTGAAGAGCA TGGGAGTGGACAGTGTGAGGAATCTGCTGGGCCAGAACCTGGGAGATCTGCGGAAGGCCCGCAACCACCC AAATGTCATCCTGTGGATGCACAGCCACAACATGACAGACCTGTCTGATATGGGCCTATACACCAGCCCC ACACAGGCCTATGTGGCCAACAGGCCCCCCAACACTGCCTACCCACCATCCAGTTTGATCCACTCCTTGG ATCCGCCAGGCAATGATGGGGTTTCCCACACCTCAGGAAGTCCTCCAGTTCATCTGGGGTACCTGTCACT CGCTGTGGCTCTGCCTTCCAGCCTTCTGTGGCTGCTACTGTGTCAGTTACCTTCGGGACAAATGGCCACT GCTCACAGGACACTAGGGCCAATGGCACTGGCCCAGGGCAGTTGGACCCCTGAACATCAGATTCCAGAGA AACGGAGCTGCTAGATGGGACAGGACACCTGCCTAGGCTGAAGTACATGTCCCCAGCCCCAGGGGACCTG CTGCTATGTCCCCATCCTAGGAGGCTGTCTCTGACTCCCAGGATCTGAGCCCATTCTGCCCAACTAAAAG GACAAATTGGTAGGAGGAGACAGAGTCCAGATCTTCTGGCCTATTCCAAGATAGATGGGACTCGGTGTTA CTTGAATGTCACTTGCCCTCGATGGCGGATCTGAATAAAGCACAAGGCCATTGCAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_177822
ORF Size 2058 bp
Insert Size 2058
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC052484, NP_808490
RefSeq Size 2416
RefSeq ORF 2058
Locus ID 328783
Cytogenetics 17|17 A3.3

Other Versions

Other products for "Mslnl"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies