Fam96b (NM_026753) Mouse Untagged Clone

CAT#: MC203239

Fam96b (untagged) - Mouse family with sequence similarity 96, member B (Fam96b), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fam96b
• Synonyms: 1110019N10Rik
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC055880
  CGCGGTTCCGGGATGGTGGGCGGCGGCGGTAGCGGCGGCGGGCTCTTAGAGAACGCTAACCCCCTCATCT ATGAGCGTTCCGGGGAGCGGCCAGTGACGGCGGGCGAGGAAGATGAGGAAGTGCCGGACAGCATCGACGC CCGGGAGATCTTCGATCTTATCCGCTCCATTAATGACCCGGAGCATCCACTGACACTGGAGGAATTGAAC GTAGTAGAGCAAGTTCGGATTCAGGTTAGCGACCCAGAGAGCACAGTAGCAGTGGCCTTCACACCCACCA TCCCACACTGCAGCATGGCCACGCTTATTGGCCTCTCCATCAAAGTCAAGCTGCTGCGATCCCTTCCCCA GCGGTTCAAGATGGATGTACACATTACACCCGGGACCCACGCCTCCGAGCATGCAGTGAACAAACAACTT GCAGATAAGGAGCGAGTGGCAGCTGCCCTGGAGAATACACACCTGCTTGAGGTTGTTAATCAGTGTTTAT CCGCCCGCTCGTGAGCCTGGCTTTGGACCCCCAGCCTGCACTCAGGTTGTCCTGGCCTCAGCTCCACCAA GGGCTCATGGCTTTGTTTTCTTGAATCACTGACAAGGAGAAACTTAACACTTTTTATTTTGTAATAAACC CTTAATTTATATTCATTTCCCAGTAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_026753
• Insert Size: 492 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC055880, AAH55880
• RefSeq Size: 672 bp
• RefSeq ORF: 492 bp
• Locus ID: 68523
• UniProt ID: Q9D187
• Cytogenetics: 8 D3
• Gene Summary: Component of the cytosolic iron-sulfur protein assembly (CIA) complex, a multiprotein complex that mediates the incorporation of iron-sulfur cluster into extramitochondrial Fe/S proteins. As a CIA complex component and in collaboration with CIAO1 and MMS19, binds to and facilitates the assembly of most cytosolic-nuclear Fe/S proteins. As part of the mitotic spindle-associated MMXD complex it plays a role in chromosome segregation, probably by facilitating iron-sulfur cluster assembly into ERCC2/XPD.[UniProtKB/Swiss-Prot Function]