Necap2 (NM_025383) Mouse Untagged Clone

CAT#: MC203213

Necap2 (untagged) - Mouse NECAP endocytosis associated 2 (Necap2), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Necap2 (NM_025383) Mouse Untagged Clone
Symbol Necap2
Synonyms 1110005F07Rik; AA409105; C78898
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC037069
CCACGCGTCCGCGGAAGTCCCGAGGGCTCGGGCGATAGAGATGGAGGAGAGTGAGTACGAGTCTGTTCTG TGTGTCAAGCCGGAGGTCCACGTCTACCGCATCCCGCCGCGGGCCACCAACCGTGGTTACAGGGCCTCAG AATGGCAACTGGACCAGCCATCGTGGAGTGGCCGGCTGCGGATCACTGCGAAAGGGAAGGTGGCCTACAT CAAGCTGGAGGACAGGACCTCTGGGGAGCTCTTCGCGCAGGCCCCCGTGGACCAGTTTCCCGGCACCGCA GTGGAGAGTGTGACAGACTCCAGCAGGTACTTCGTCATCCGAATTGAAGATGGAAACGGGCGACGTGCTT TTATTGGGCTTGGCTTTGGAGACCGAGGGGACGCCTTTGACTTCAACGTGGCATTACAGGACCATTTCAA GTGGGTGAAGCAGCAGTGTGAGTTTGCGAAACAAGCGCAGAACCCAGATGAAGGCCCCAAGTTGGACCTG GGCTTCAAGGACGGCCAGACCATCAAGATCAACATCGCAAACATGAGGAAGAAGGAAGGAGCAGCTGGTA CCCCAAGAGCCAGGCCCACCAGCGCAGGAGGGCTGAGCCTGCTGCCCCCTCCTCCGGGGGGCAAGAGTTC CACTGTCATCCCTCCCTCTGGAGAGCAGCTGTCTGTGGGGGGCTCTCTGGTTCAGCCAGCAGTTGTTTCT GGTTCAGGAGGTGCCACAGAACTCTGGCCACAATCTAAGCCTGCTGCCGCTGCCACTGCTGATATCTGGG GAGACTTCACCAAATCCACAGGGTCCCCCTCCAGCCAGTCTCAGCCAGGCACCGGCTGGGTCCAGTTCTG ACCTGCACAACCTTTTACTCAGCCGACTTCTGGGAAGGAGCTGCCTCGTCCTGACCCACGGAAGGTGGCA GTGCTCCCTGCCTGGTCCCTGGCCCCTGGCCCCTTGCCTGGCTGGCTTGACAGCCTGAGCACAAGAAGCA GTAAGTTGGCACCTTGCCACACTGTTGGTTGGGCCCAGGTGCTGCTCAGCCAGGAAACGGGAGCAAACAC TCCAGGGCCTTTACAAGCCCATCGCCCTCCTCACTGGAGACACCCAGACCTGCCTTCCTCCACCAAGAGA TCCTTATTAAACACAGCCCCCAAAGCACAGAATGGATTCAATTTGTGGCCTGGGTTCAGCTCTGCCTCTC CAATTGGCAGGTGTCCCAGATTTGCTGTTGGACAGGGACCTTCTGCACTCCATCCATAGTAGCCTTTGTC TGGTACCTTCCAGAGGAATCCTTCCCGAGAGCTGGCAAGTCTTTGAGCTATAGCTTGAATGGGCTGTCGG GGGACACTGGAAGGGAGTAAGCAGCTTTTTGAAAATGTTAATACATTACTCTGCTAATATGCTGACCTGC ACTAATGCACCCCTGTGAGGGACCCCCCATGGCGAGGGCCTCTGCCTCTGACACACCCTTCTCGCTGCCC TGAGCCCCGGAGGCAGCCATGGGAGGCAGCCTGCATACCTGGAAGCCAGCTGCACAGTGCTGTGGGGAAA CGGAAGCGTTACAGACCGGGCCAGGCTGCCTGGCTGCTGCTCCCTCTGGGCTCATAGCTGGCCCACTTGA CGGTCCCTGGTGGCTTCTGGAGGGAAGCTGTACCTCTGGATACATTTTTCTTTTCCTTCAGAGACCGTGA CAGAGGGAGCTCTGTCAGCGGGAAGTTCAGGCCACCAGGAGTAGTGATTTGTAAGAAATTACTGTCTCCT CAGTGAACCTCCTAGTCTCTTTATAGACTTAACCTTCCCTTCAGTTAAAGGGTTTCTTTTTCGGAGGGCC TAGACTGTGCTGACCTTGTGTGACCAGAGATTTAAAGATGAAAAAAACAATAAATGTGTTTACTTCTGCA AAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_025383
ORF Size 801 bp
Insert Size 801
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC037069, NP_079659
RefSeq Size 1904
RefSeq ORF 801
Locus ID 66147
Cytogenetics 4|4 D3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.