Nemp1 (NM_173732) Mouse Untagged Clone

CAT#: MC203200

Tmem194 (untagged) - Mouse transmembrane protein 194 (Tmem194), transcript variant 2, (10ug)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Nemp1 (NM_173732) Mouse Untagged Clone
Symbol Nemp1
Synonyms Tmem194; Tmem194a
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC030440
CCACGCGTCCGGGGCACGCGAGGAGGAGGCGGTGTGAGGCATCCATGGCGGGAGGAATCAAAGTGTCGGT GTGGTCGGCGGTTGGTCCAGGGCCCCGGTGCTGGGGGGCCGGGGGCGGCGGCGGCGCCACATGGCTGCTC TTGGTCGTCGCCGGCTGCGTGGTCTGCGGCTCAGCTGATGTAAATGTGGTCATGCTTCAGGAATCCCAAG TTGATATGAATTCCAGTCAACAATTCTGTTATAAAAATGTGCTTATCCCAAAGTGGCATGATATATGGAC ACGGATACAGGTTCGGGTAAATAGTTCCAAGTTGGTCCGAGTTACCCAGGTGGACAATGAGGAGAAGCTG AAGGAGCTAGAGCAGTTTAGTATCTGGAACTTTTTTTCTTCTTTTTTAAAAGAGAAATTGAATGACACCT ATGTTAACGTGGGTCTGTACAGCACTAAAACCTGCCTCAAGGTTGAGATGATAGAGAAGGACACCACGTA CAGTGTCACTGTGACCCGGAGATTTGACCCCAAACTCTTCCTTGTTTTCCTCCTCGGACTGACACTGTTT TTTTGTGGAGACTTGTTGAGCAGGAGTCAAATTTTCTACTATTCCACTGGGATGAGTGTGGGAATCGTGG CCTCTCTCTTAATCGTCATTTTTATGATCTCTAAGTTTATGCCCAAGAGAAGCCCCATTTACGTCATCCT GGTAGGAGGCTGGTCCTTCTCTCTGTACCTCATTCAGCTAGTTTTTAAGAATTTACAGGAGATATGGAGG AGTTACTGGCATTATCTTCTAAGCTACATCCTCACAGTTGGATTCATGAGTTTTGCAGTGTGCTACAAAT ATGGGCCCCTGGAAAATGAACGAAGCATTAACCTGCTGACCTGGACGCTGCAGCTGCTGGGCCTGGGACT CATGTATTCCAGTATCCAGATCCCGCACGTTGCCTTTGCTCTCATCGTCATTGCACTGTGCACTAAGAAC CTGGAATACCCTATCCACTGGCTGTGCAGCACCTACAGGTGACTAGCAGGCAGGGTGACTGTTGACATGT GGGGTATGGGATGCACTTGCAGCGAAAGGATGCTTAGTTTTTCCTTGGGAACCTCTGTAAGTGGGATGTC ACCTGCTCCCACCCTTGTTCCTTTCTCTGTTGAGATAATACTTTTTTTCTTTTTTTATAATAAAAGCAAC CAGTAAAGTGTCATGTGTTCCTGCTACCACTAGGTGGTGCAAATTATATCAGTGTTTGGTTTGTACATAG GCCTCAAGTTCAGGTTTCAGATCATGTCACGCTGACTGTCAAGTTGCTCTAAAACCTTAATTTTATTTGA GATGTAATTCATAGCATGGTATTCTTGGAAAAGTCAATATGGAGTGGCCCTGGATTCTGAAATGGCCATG GCTGCTCCATTGCAGGTAATCAAAACAGTACCTTCAGAGTGAGGACCTGAGGTCACAAACCACAACATTA TAACATCATTTTGTTGTTTTCCCACTTATTGGAAAATAAATTATTTGTCATTTATTTGAAAAAAAAAAAA AAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_173732
ORF Size 978 bp
Insert Size 978
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC030440, NP_776093
RefSeq Size 1544
RefSeq ORF 978
Locus ID 210035
Cytogenetics 10|10 D3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.