Psma2 (NM_008944) Mouse Untagged Clone

CAT#: MC203152

Psma2 (untagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 2 (Psma2), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Psma2 (NM_008944) Mouse Untagged Clone
Symbol Psma2
Synonyms Lmpc3
Vector pCMV6-Kan/Neo
Sequence Data
>BC026768
GTAAAGATGGCAGAGCGCGGTTACAGCTTCTCGCTGACTACATTCAGCCCATCTGGTAAGCTTGTCCAGA TTGAATATGCCTTGGCTGCGGTAGCTGGAGGGGCCCCTTCAGTGGGGATTAAAGCTGCAAATGGCGTAGT ATTAGCAACCGAGAAAAAGCAGAAATCCATCCTGTATGATGAAAGGAGTGTTCACAAGGTGGAGCCCATT ACCAAGCACATCGGTTTGGTGTACAGTGGCATGGGCCCCGATTACAGAGTACTTGTACACAGAGCTCGGA AACTTGCTCAGCAATACTACCTTGTTTACCAAGAACCCATTCCCACAGCCCAGCTGGTACAGAGAGTAGC CTCTGTGATGCAGGAGTACACGCAGTCAGGTGGTGTTCGTCCATTTGGTGTTTCTTTACTCATTTGTGGG TGGAATGAGGGACGACCATATTTATTTCAGTCAGATCCATCTGGAGCTTACTTTGCCTGGAAGGCCACAG CAATGGGAAAGAACTATGTGAACGGGAAAACTTTCCTTGAGAAAAGATATAATGAAGACCTAGAGCTGGA GGATGCCATTCATACAGCCATCTTAACCCTAAAGGAAAGCTTTGAAGGGCAGATGACAGAAGATAACATA GAAGTTGGGATCTGCAATGAGGCTGGCTTTAGGAGGCTCACTCCAACTGAAGTGAGGGATTACCTGGCTG CCATAGCGTGATGAAGATGTGCTCACACACTCGACTTTTTCATGTTTAAAGTATGTTTTGTTTGTGCAGA CTTATTTCTACATGGTTTAGTGGATTCACATTTTAAAAATAATCATAATAAACTGTTAAAACCAAAAAAA AAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_008944
ORF Size 705 bp
Insert Size 705
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC026768, NP_032970
RefSeq Size 848
RefSeq ORF 705
Locus ID 19166
Cytogenetics 13|13 A1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.