Yeats4 (NM_026570) Mouse Untagged Clone

CAT#: MC203132

Yeats4 (untagged) - Mouse YEATS domain containing 4 (Yeats4), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Yeats4 (NM_026570) Mouse Untagged Clone
Symbol Yeats4
Synonyms 4930573H17Rik; B230215M10Rik; GAS41; NuBI-1
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC020043
CCAGCTCGGGGCTGAATGGCCGACCCCGACGCGGCGCGTGTGGAGGAGGTGGCTGTCCGGCTCCCCGAGC CCAGGCGACCCGCCCTCCTCCGGCTCGTGAGGGGAGCGGCTACCCCGCCGGCCTGAGCTCTCTCCCTGGC CGCCGCGGCTCCTTCCCGGGGACAATATGTTCAAGAGAATGGCGGAATTTGGACCTGACTCCGGCGGGAG AGTGAAGGGGGTTACCATCGTTAAGCCAATCGTTTATGGCAATGTTGCCAGGTACTTTGGAAAGAAGAGA GAAGAAGACGGGCACACTCACCAGTGGACTGTGTACGTGAAGCCCTACAGAAACGAGGATATGTCAGCAT ATGTGAAGAAGATCCAGTTTAAATTACACGAAAGCTACGGCAATCCTCTAAGAGTCGTCACCAAGCCTCC ATATGAAATCACAGAAACAGGATGGGGTGAATTTGAAATCATCATCAAGATATTTTTCATTGACCCCAAC GAGAGACCTGTGACTCTGTACCACTTACTGAAGCTCTTCCAGTCTGACACCAATGCCATGCTGGGGAAGA AAACAGTGGTTTCAGAGTTCTATGACGAAATGATATTTCAAGACCCAACGGCAATGATGCAGCAGCTGCT TACGACGTCTCGCCAGCTGACATTGGGAGCCTATAAGCACGAAACAGAGTTTGCAGAACTTGAAGTGAAA ACCAGAGAAAAATTAGAAGCTGCCAAGAAAAAAACAAGCTTTGAGATTGCGGAGCTTAAGGAGAGATTAA AAGCAAGTCGTGAAACTATAAACTGTTTAAAAAATGAAATCAGGAAGCTTGAAGAAGACGATCAGACGAA AGACATTTGAGCAACTGGCGGTAAGTCGGCTGCAGAGCCAGGGCGCCGCGGAGTTTCTGGGAGGAGCTGC GAGTGCGGTCCCCAGCTGGCCGTGGCTTTCTCAGAGAGGACTCCAGGTACCCACACTGTCAGGCTGCCTC CCGGGGCACATGTGTGCTCTAAGACTCGATGCTGGGTAGCATTCCACGATGTTAAGCACAACTTTTAAAG TGTTTGTTTTGTTTTAAATTGAACTCTATGTGTAGTTTATCCTCCTCAGGCAGGCGTAGCGGTTGTGTTG TAAAGTCTAACGTGTGCGGGTTTTGTACCTCTCTCCTAGGTAGGATTAGTGACTGGTATGTGTGTTTAGT TCTTCAGGTCCACATCTGCCCCGGTCTACCTCTTTTGTATATGATGTATCTAGGAAGTGTTTAATAAATG TAGTTTACTGCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_026570
ORF Size 684 bp
Insert Size 684
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC020043, NP_080846
RefSeq Size 1306
RefSeq ORF 684
Locus ID 64050
Cytogenetics 10|10 D2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.