C8g (NM_027062) Mouse Untagged Clone

CAT#: MC203121

Reviews ()
Write a review

C8g (untagged) - Mouse complement component 8, gamma polypeptide (C8g), (10ug)


  View "NM_027062" in other vectors (6)

USD 210.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name C8g (NM_027062) Mouse Untagged Clone
Type Mouse Untagged Clone
Tag Tag Free
Symbol C8g
Synonyms 1700013L23Rik; RP23-47P18.13
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>BC019967
CAGTTATTGCATGCATAGGGTTGAGCACTGACCACAAGTGGAAATAGGGGTGCAGAGGTCAACTCTTAAC TTTGCACTTGGGACACAATGCCCAGCTCCTATCAAGGCTAGGTTCTAGGATGGACCCTGGCTTGGGTTAG GGGTTCAGTAATCGGAAGACAGATGTGGACTTCCTGGACTGTGCTTCCTGTGGCACTGGACAGTGGACTC TGACCTAGGACAGTGCACCCCTCCACCTCGCTGTCCTGTCACCTACTGTCCGTAGCAGGTTGGCCATGCT GTCTCCAGGGGCTGTGTTGTTCTTCACCCTGCTCTTGACAGCCAGTTCGCTGGGCCAAAGGACTCGAAAG CCTATTGGGTCTACCTCCCCCATCAGCACTATCCAGGCCCAGGTCAATTTCAGTGCTCAGAAGTTTGCAG GGACATGGCTCCTGGTGGCTGTGGGCTCTTCGTGCCGCTTTCTTCAGGAGCAGGGACACCGAGCTGAGGC CACCACATTGCACGCAGCTCCCCAGGGTGCAGCTATGGCTGTCAGCACCTTCCGAAAGCTAGATGGGATA TGTTGGCAGGTACGCCAACTCTTTGAGAACACAGGGGTCCCTGGCCGCTTCTTGTTCCAAGTCTCACGGG CCCGTGGACCAGTGCATATGGTGGTTGCTGAGACTGACTATCAGAGCTTTGCCATCCTGTACCTGGAACA GGGAAGGAAGCTGTCTGTGAAACTATACGTCCGCTCACTGCCAGTGAATGACTCTGTCCTGGATGTGTTT GAGCGGCGAGTCAGGGAAGCCAACCTGACAGAAGATCAGATTCTTTTCTTTCCCAAGTATGGTTTCTGCG AGACTGCGGACCAATTACACATCCTGAACGAGGTGCCGCGATAAGGCCATCTAGTGGAGAAGCTGTGGAC AGTGGGCTACCCTCAGAGAGTTCTGAGCATCCTGAATGCACTCTTGGAGTCTCTCCTTTCTGTCCCCAGA AGCACCCCTTCATACAGCTCTGTTGTCCTAGGTCTTTTCATTAAACATCAGACTTGGCAAAAAAAAAAAA AAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_027062
ORF Size 609 bp
Insert Size 609
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC019967, AAH19967
RefSeq Size 1063
RefSeq ORF 609
Locus ID 69379
Cytogenetics 2 17.31 cM
Gene Summary This gene encodes a secreted protein that is a core component of the complement 8 (C8) complex. C8 is part of the membrane attack complex which participates in the innate immune response against bacterial pathogens. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones