Pcsk9 (NM_153565) Mouse Untagged Clone

CAT#: MC203075

Pcsk9 (untagged) - Mouse proprotein convertase subtilisin/kexin type 9 (Pcsk9), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Pcsk9 (NM_153565) Mouse Untagged Clone
Symbol Pcsk9
Synonyms AI415265; AI747682; FH3; HCHOLA3; Narc1; PC9
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>BC038085
CCACGCGTCCGGGAGTGGGGATTAAGAGGGGGGAATGTAACAGGTCCCGTTTGCAGCCCAATTAGGATTT GGGGTTTTGTCCTCACTCTGAGCGTCATTTGACGCTGTCTGGGGAGGGCGAGGCCGAAACCTGATCCTTT AGTACCGGGGCCCGTTAATGTTTAATCAGAGAGGATCTTCCGATGGGGCTCGGGGTGGCGTGATCTCCCG GCCCCCAGGCGTCCAGTACCCACACCCCAGAAGGCTTCCACCTTCACGTGGACGCGCAGGCTGCCGGTGG GCTCCCGTTCTCTCTCTCTTTCTGAGGCTAGAGGACTGAGCCAGTCCTTGGCTCCCCAGAGACATCACGG CCCGCAGCCCCGGAGCCAAGTGCCCCGAGTCCCAGGCGTCCATGTCCTTCCCGAGGCCGCGCGCACCTCT CCTCGCCCCGATGGGCACCCACTGCTCTGCGTGGCTGCGGTGGCCGCTGTTGCCGCTGTTGCCGCCGCTG CTGCTGCTGTTGCTGCTACTGTGCCCCACCGGCGCTGGTGCCCAGGACGAGGATGGAGATTATGAAGAGC TGATGCTCGCCCTCCCGTCCCAGGAGGATGGCCTGGCTGATGAGGCCGCACATGTGGCCACCGCCACCTT CCGCCGTTGCTCCAAGGAGGCCTGGAGGCTGCCAGGAACCTACATTGTGGTGCTGATGGAGGAGACCCAG AGGCTACAGATTGAACAAACTGCCCACCGCCTGCAGACCCGGGCTGCCCGCCGGGGCTATGTCATCAAGG TTCTACATATCTTTTATGACCTCTTCCCTGGCTTCTTGGTGAAGATGAGCAGTGACCTGTTGGGCCTGGC CCTGAAGTTGCCCCATGTGGAGTACATTGAGGAAGACTCCTTTGTCTTCGCCCAGAGCATCCCATGGAAC CTGGAGCGAATTATCCCAGCATGGCACCAGACAGAGGAAGACCGCTCCCCTGATGGAAGCAGCCAGGTGG AGGTGTATCTCTTAGATACCAGCATCCAGGGTGCCCATCGGGAGATTGAGGGCAGGGTCACCATCACCGA CTTCAACAGCGTGCCGGAGGAGGATGGGACACGCTTCCACAGACAGGCGAGCAAGTGTGACAGCCACGGC ACCCACCTGGCAGGTGTGGTCAGCGGCCGGGATGCTGGTGTGGCCAAGGGCACCAGCCTGCACAGCCTGC GTGTGCTCAACTGTCAAGGGAAGGGCACAGTCAGCGGCACCCTCATAGGCCTGGAGTTTATTCGGAAGAG TCAGCTAATCCAGCCCTCGGGGCCACTCGTGGTTCTGCTGCCCCTGGCCGGTGGGTATAGCCGCATCCTC AACGCTGCCTGCCGGCACCTGGCGAGGACTGGGGTGGTGCTGGTTGCAGCAGCTGGGAACTTCCGGGACG ACGCCTGCCTCTACTCCCCAGCTTCTGCTCCAGAGGTCATCACAGTCGGGGCCACGAATGCCCAGGACCA GCCAGTTACCTTGGGGACTTTGGGGACTAATTTTGGACGCTGTGTGGATCTCTTTGCCCCCGGGAAGGAC ATCATCGGAGCGTCCAGTGACTGCAGCACATGCTTCATGTCACAGAGTGGGACCTCACAGGCTGCTGCCC ACGTGGCCGGCATTGTGGCTCGGATGCTGAGCCGGGAGCCCACACTTACCCTGGCCGAGCTGCGGCAGAG GCTGATCCACTTCTCTACCAAAGACGTCATCAACATGGCCTGGTTCCCTGAGGACCAGCAGGTGCTGACC CCCAACCTGGTGGCCACACTGCCCCCCAGCACCCATGAGACAGGCGGGCAGCTGCTCTGTAGGACGGTGT GGTCGGCACACTCGGGGCCCACTCGAACAGCTACAGCTACAGCCCGCTGTGCCCCAGAAGAGGAGCTGCT GAGCTGCTCCAGCTTCTCCAGGAGCGGGAGGCGTCGTGGTGATTGGATTGAGGCCATAGGAGGCCAGCAG GTCTGCAAGGCCCTCAATGCATTTGGGGGTGAGGGTGTCTATGCCGTCGCGAGATGCTGCCTGGTTCCCC GTGCCAACTGCAGCATCCACAACACCCCTGCAGCCAGAGCTGGCCTGGAGACCCATGTCCACTGCCACCA GAAGGACCATGTTCTCACAGGCTGCAGCTTCCATTGGGAAGTGGAAGACCTTAGTGTCCGGAGGCAGCCT GCGCTGAGGTCCAGACGTCAGCCTGGCCAGTGCGTTGGCCACCAGGCGGCCAGTGTCTATGCTTCCTGCT GCCATGCCCCAGGGCTGGAATGCAAAATCAAGGAGCATGGGATCTCAGGTCCTTCAGAGCAGGTCACTGT GGCCTGCGAAGCAGGATGGACCCTGACTGGATGCAATGTGCTCCCTGGGGCATCCCTCACTCTGGGAGCC TACAGCGTGGACAACCTGTGTGTGGCAAGAGTCCATGACACTGCCAGAGCAGACAGGACCAGTGGAGAAG CCACAGTAGCTGCTGCCATCTGCTGCCGGAGCCGGCCTTCAGCAAAGGCCTCCTGGGTTCAGTGACAGCC TCAGGCAGGGATGGTGCTTGAGGCTGGGTGCAGAGATATGCCTGCATGGCTCTCTTGTAGCCAAAGGTGG GGAGATTCTGCGTGGGAGAACTTGGTGTCTCACCCTGGGTACCCATTCCTGGTGTATGGAAGCACCTCCT TCACGGTCAGGGGGCCTGTGCTTGGCTTTCTGCCATCAGACATTAAGCTGTAGCTGGCTCTGGCCAGCTG CTCCAGTGTACCAGAACCTGAGGATGCTCGCTGCAAGGCCTCAGTTCTCAGGCCTTAGGGTGTATTTGTC TTTCAGGAAGATCATAATGGACAGAGATCCTTGGAGGTTCAAAGACCAAGTACCAGACTGGAAAATTGAG TCTGAAAGCCACAAGGACAGTCAACTCACAGCCAGCTCACATTGCAGACACCATTTTGGGCTCCCTGATT AAATGCAGATCAGTTCTGCACACCTCCAGGGGTGGATCCAGCTGTAAGGCCATACCTATATCTTCCAGAT GTCCTCATCTGCTGCAGGGCTTTGGCCCTGCTCAGGATAATGTGCTATGAGCCCTCATCTGACTCTCAGT TTGTACTGGAGAACCATACAGGACTTACCGCACCTTACCCCATCCACTACCATGTGCACTGACTGGCCTC ATTTTATGAAGGAAGAGACAGGACCAGAGAGGCGATGTCACACAGCCAGTGATGTCAGGACATAAATTCA GAGTGGCTGGCCCTGAATAATGCCAGGCTGGGCAGCGAGAGGACAGGCTATGGCTTGCTCCTGGACCTAT ACTCCCTTAGCCCCAGTCCCACAGATCAGGTGGAGACTGGAGTGACAGAGGGCGACTGTACCAAGGCCAC ACCAGCTGACCAGCACACCTCTATCCTTTTGAGCTCTTCTGTCTTTTTATAGTAAGCTTCCTCCACCTGT GTTGCTTTTGTAACTTGATATTTATGCAGGGTTTTGTAGTTTTTATTATGTAGTGACTTTTCAGAATAAA AGCAGCTGATGTGACTGACAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_153565
ORF Size 2085 bp
Insert Size 2085
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC038085, NP_705793
RefSeq Size 3534
RefSeq ORF 2085
Locus ID 100102
Cytogenetics 4|4 C7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.