Rell2 (NM_153793) Mouse Untagged Clone

CAT#: MC203064

Rell2 (untagged) - Mouse RELT-like 2 (Rell2), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Rell2 (NM_153793) Mouse Untagged Clone
Symbol Rell2
Synonyms 4631403P03Rik; ependolin
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC038500
CCACGCGTCCGGACGGTTTCGGAGGCGCCCTCCCCCAACCCCTCTATTTTCCCGGCCGGAGTAATCCGGA GCCTGTCGCGGTTCCCTACCGGCCCACATCCTTCCCTCCCCCCGTCTGCCGCGGAACCGGTATCCGCAGC CACCAGCCCGGAGCCGGTGAGGCGGCAAAGGGGGGAGGGGGAGGAAGCAAGGGATGAGCTCCGGGAGGGC GTCGGGGGCCCTGAGCCGGACGAGGACGCCCCTGGAGCCGGGACCCGAACCGGAGCCGGAGCCGGAGACA GAACCAAACCACCGCTGCAGCCCACTAAACCCAGGAGGCGCCCTGGCCCGCGCTCGCCCCCCAGGGCCTC ATGTCGGAACCACAGCCTGACCTGGAGCCGCCCCAACATGGGCTGTACATGCTCTTCCTGCTTGTGCTGG TCTTCTTCCTCATGGGCCTTGTAGGCTTCATGATCTGCCACGTGCTCAAGAAGAAAGGCTACCGCTGCCG CACGTCTAGGGGCTCAGAGCCTGATGATGCCCAGCTCCAGCCCCCTGAAGACGATGACGTGAATGAGGAC ACAGTAGAGCGGATTGTTCGCTGCATCATCCAAAATGAAGCCAATGCTGAGGCCTTGAAGGAGATGCTAG GGGACAGTGAAGGAGAAGGGACGGTGCAGCTCTCCAGTGTGGATGCCACCTCCAGCCTGCAGGACGGAGC CCCCTCCCATCATCACACAGTGCACCTTGGCTCTGCAGCTCCTTGCATCCACTGCAGCCGCAGCAAGAGG CCCCCACTTGTCCGTCAGGGTCGCTCTAAGGAAGGAAAAAGCCGTCCCAGACCTGGAGAGACCACTGTTT TTTCAGTGGGCAGATTCCGAGTAACACACATTGAGAAGCGCTACGGCCTACATGAACATCGTGATGGTTC CCCTACGGACAGAAGCTGGGGCTCTGGTGGAGGGCAGGAGCCAGGGGGTAGTCAGGCGGCTGGAGGAGGG CAGCCTAGGACAGGGACAGCTGCCATTGAGAGGCTGCTCCCTGAGCCGCCACCCTCCCAGGCCGCAGCCA CCCACTCAGTGCAGAACGGAAGACTCCAGGATGCCAGCCTCGTCCCTTGTACACTTGAGGGGACCCCTGG AACCTCTGCAGAACTGAACTTGGGCCCTAGAGGGAGAGACCCAAGCCCAGGGCTGTCTAGTCAAGAAGCA AATGGACAGCCAACCAAACTGGACACCTCAGGTCAGCAGGTATGAAGACATGCCCAGGGCTGCACTGGGC AGTGGCGGACACACATCTTACCATCCCTACTCTGGGCAACGTGGGTATGATCCACTTCCTGTTCCCACTG AATCCTTCCCCCTCCTCTCAGGAGTCTCTACCACCAGAAGCAGGGGGTATGTGAGCCAAGTCTCCCTGAG CTCCAGATCAGGTAATCTCACCCTCCTGCCCTCTATCTAAACTACTCAAGCCCATCAACTCCCTGAATCC TGGAGGTGGGTGAACTGTAAGCTTAGTGTGTGGGGAGCGGGCACAGGTTCCTCCAGGAGATACAATACAA TGCCTGGAGAACAGAGCTTGACTAGGCAACAACACTGCTTCCCTTCCTTTCTTCCAAGCCTCAGTCTTCA CTGTGCTGATGGGTTACCAGCAGGCATTGCCAGGGGACGGATAGCCAGGAAGGCTCTCCCCTCCACTGGA CAGCTCTGCCCCTCAGTTGAGGGACCAACTCTACTTCCATCTGGAGATACATGGTCCCCGGCTGAGAGCC CTCAGGAGGAGCCCCTCCCAATTCCCAGCCCCTCATTCTGTTCCCTTTCCCCACCTGCCAACAGGTTGCC TGGCCTGCCTTCCCCAAAACCTCGCTCCACATGCTAGAGCGTGGCTGCTGGGACCAGGCCCTACCCTCGG TGGGCCCCTAAAGCAATAGCACCTTAGGCCCCCTGCCATCTTGGCACAAGAGGCCCAGGCCCTGGCTTGG ACTTCATACCCTTTATTCACTGTCAATAAATCCGCTCAGACCAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_153793
ORF Size 885 bp
Insert Size 885
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC038500, NP_722488
RefSeq Size 2090
RefSeq ORF 885
Locus ID 225392
Cytogenetics 18|18 B3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.