Sec11c (NM_025468) Mouse Untagged Clone

CAT#: MC203063

Sec11c (untagged) - Mouse SEC11 homolog C (S. cerevisiae) (Sec11c), (10ug)


  "NM_025468" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Sec11c Antibody - C-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Sec11c"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Sec11c
Synonyms 1810029G24Rik; Sec11l3
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC037187
CCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGCGGACGCGTGGGCAGACAGAGCCGGCCGGCCGCCT GGGCCCCCAGAGACCCCGCCATGGTTCGTGCGGGCGCCGTGGGGACGCATCTCCCCACGTCCAGCCTGGA CATCTTTGGGGACCTGAGGAAGATGAACAAACGACAGCTCTACTACCAGGTTTTAAACTTTGCCATGATC GTGTCTTCTGCGCTCATGATCTGGAAAGGCCTGATTGTTCTCACGGGCAGCGAGAGTCCCATCGTGGTGG TACTCAGTGGCAGTATGGAGCCGGCCTTCCACAGAGGAGATCTGCTGTTCCTCACGAATTTCCGGGAGGA CCCCATCAGAGCTGGTGAAATAGTTGTTTTTAAGGTTGAAGGAAGAGACATTCCGATAGTTCACAGAGTA ATCAAGGTTCATGAAAAAGATAATGGTGACATCAAGTTTCTGACTAAAGGAGATAATAATGAAGTCGATG ATAGAGGCTTGTACAAAGAAGGCCAGAACTGGCTGGAGAAGAAGGACGTGGTAGGAAGAGCTCGAGGGTT CTTACCTTATGTTGGCATGGTCACCATCATAATGAATGACTATCCAAAATTCAAGTATGCTCTTTTGGCT GTGATGGGTGCATATGTGTTACTAAAACGTGAATCCTAACATGAGAAGCAGTTCCTGGGACCAGACCGAA ATGAGTTCTGTTGAAAAAGAGAAAAGCTAATATATTTGAAATGTTCCACTTTCTGTATAAAGAGAAACCA GGTGGGGATGTTTTTGTCTTATCTAAATAAATGATTCACCAGTAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025468
Insert Size 579 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC037187, AAH37187
RefSeq Size 829 bp
RefSeq ORF 579 bp
Locus ID 66286
UniProt ID Q9D8V7
Cytogenetics 18 E1
Gene Summary Component of the microsomal signal peptidase complex which removes signal peptides from nascent proteins as they are translocated into the lumen of the endoplasmic reticulum.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.