Tmem268 (NM_144905) Mouse Untagged Clone

CAT#: MC203004

6330416G13Rik (untagged) - Mouse RIKEN cDNA 6330416G13 gene (6330416G13Rik), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tmem268 (NM_144905) Mouse Untagged Clone
Symbol Tmem268
Synonyms 6330416G13Rik; AW492431; bM230C2.2
Vector pCMV6-Kan/Neo
Sequence Data
>BC022599
CGCTGCCCCAGCATGAACTGCACCCCCAGAAACAGGAAGTAGAAGCTAGAGCAGCTGTCTGTCTGCCATG GCTTGTGAGCCTCCCACAGATCCTGGTGGGGCAGCTGGTCCCCTGCCCACCTCTACCCTTGGCTGCAACA TCCTGCCTCAGGGGAACCCTCCTGGCTGGGGGCAAGAGCTACACAATGGCCAGGTCCTCACAGTCCTCCG GATCGACAATACCTGTGCACCTATCTCCTTTGACCTGGGAGCTGCAGAAGAGCAACTGCAGGCCTGGGGC ATTCAGGTCCCTGCTGAGCAGTACAGGAACTTGGCTGAGAGTGCCCTTTTGGAACCTCAAGTGAGGAGGT ACATCATCTACAACTCCAGGCCCATGAGGCTGGCCTTTGCTGTGGTGTTCTACGTGTTGGTGTGGGCCAA CATCTACTCCACCAGCCAAATGTTTGCCCTGGGCAACCAGTGGGCAGGCGTGCTGCTTGCGACCCTGGCT GCTTTCAGCCTGACCCTGACCCTTGTGCTGGTCTTTGAGAGGCAGCAGAGGAAGGCCAACACTAACACAG ACCTGAGGCTGGTGGCCGCCAATGGAGCCCTTCTGCGACACCGTGTGCTGCTGGGGGTGACAGACACAGT GGAGGGATGCCAGAGTGTGATCCAGCTCTGGTTTGTCTACTTCGATCTGGAGAACTGTGTGCAGTTTTTG TCCGACCATGTTCAAGAGATGAAGAGGAGCCAAGAGTCCTTGCTGAGAAGCAGATTGAGCCAGCTGTGCG TTGTCATGGAGACTGGAGTGAGCCCTGTGGTGGAAGGGCCCGAGGATTTGGAGGATGCTCCCCTCCTGCC CAGCACTCCTGGTCCTCAGGAGAGGCCACTCACACAGACTGAACTCTATCAGCTTGTTCCAGAGGCTGAG CCGGAGGAGATGGCCCGGCAGCTACTGGCAGTGTTTGGTGGCTACTACACCCGGCTCCTGGTGACCTCTC GGCTCCCTCAGTCAATGGGAACGCGACACATGGACTCTGCAAGGATCCCATGCCCCTGCCAGCTCATAGA AGTACACGTTCTGGGCACAGGATGTTGCCCGTTCCTGGCTAGGTGACCTAGGGATGGAGATGTTCCTCTT CCTCCAAGACTGAGAAGTGGGGGAGGAGTCAGGAGCCCAGCATGGGAAACAGCGAGCTCAGATGAGGCCA GCATTTGGGAACACTTTAGCGAGTCTCAGTCATGTAGGCCTTGGGGTCACCAAGCGCACACCAGATGCCT TCTTGGCATCACATGCTCGCCTGGCCTTGCTGAATCTGGTGGATGAGCTGGAGTTACTTGGGCTTGTGGC CTGCGTGGAGGGTCCTTTCTGTTGCCTGAAAATCCCTAGAGAACTACAGCAGGCTCCACAGGGCAAGTCC CTGACTTTTGGAGTCAGAAGGTGAGACTGAGGCTCTTAGAGGATGCTGCTCCCTCAGCATTGCCTCAGGC TGCCGATGTCACAGTCCTACCTGCTTCCAGTGGGAGGGAAGATTCTCAGCAGGGTGAGCTAGCTTGTGAG CTACAGTACTGTCTGGGATTGTTGTCTCTTAGCACTCAGGTTATAGAGGACCAGGGTTGGAGGACAGGGG AGAGGAGGAGTCAAAAAGCCGATGCCCGTCAACACGGCGCTGGAAAAGAAGACCCTGTTGGCCTCAGACT GTCTTTGTGTGGCAACACGCTTTCTTGAGATGTGATTCTGTCCTGCTGAGCAGCAGCGGTGTTTTCAGAC ACTAACATTGTTCTGGAATGACATGTGATCAGACACTCTGAGCTTGTGTGAAGAACTCAGAGACTTTCCC AAAGTTTGAAGACTGTCCACAGCCCTATGCCCAAAGCCCTGGTCTGGTGTGAAGGTCTTACTCAAAAACC AACCTTTGTGGTTTTTGTCCCCGACAAATCATCATTATAAGTTGGAACTCTTCCTTGAAAAAAAAAAAAA AA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_144905
ORF Size 1029 bp
Insert Size 1029
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC022599, NP_659154
RefSeq Size 1962
RefSeq ORF 1029
Locus ID 230279
Cytogenetics 4|4 C1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.