Sdsl (NM_133902) Mouse Untagged Clone

CAT#: MC203001

Sdsl (untagged) - Mouse serine dehydratase-like (Sdsl), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Sdsl (NM_133902) Mouse Untagged Clone
Symbol Sdsl
Synonyms 4432411H13Rik; AI504310; SDH1; SDS-RS1; TDH
Vector pCMV6-Kan/Neo
Sequence Data
>BC022601
GGCCTTCCTGATTCTGTCTCACGTGGCTTCGTTCTTAGGTAAGGTGGTCAGCGCGCTGCTGGAATGGAGG GGGCCTTGGCAGAACGCGTCGGGGCGGAGCCTTTCCACAGGGTCACGCCCCTGCTGGAGAGCTGGGCGCT GTCTCAGGTGGCAGGCATGCCGGTCTTCCTCAAATATGAGAATGTGCAGATAGCTGGCTCCTTTAAGATT CGGGGCATCGGACATTTCTGCCAGCAGATGGCCAAGAGGGGATGCAGACATCTGGTGTGCTCCTCAGGGG GCAATGCGGGCATTGCGGCTGCATACTCGGCTCGTAAGCTGGGCATCCCCGTCACCATCGTGCTCCCAGA GGGCACCTCCGTGCAGGTGGTGAGGCGGCTCGAGGGGGAAGGGGCCGAGGTCCAGCTGACTGGGAAAGTC TGGGATGAAGCCAATGTAAAAGCACAAGAACTGGCCACAAGGGATGGCTGGGTGAACGTCTCCCCGTTTG ACCATCCCCTTATATGGGAAGGCCATGCCAGCCTAGTGCGGGAGCTGAAGGAGTCACTAGGGACCCCTCC AGGTGCTGTGGTGCTGGCCGTGGGGGGCGGAGGGCTCCTGGCAGGTGTGACTGCTGGCCTGCTGGAGGTG GGCTGGCAGCATGTGCCCATCGTTGCCATGGAGACCCGCGGGGCGCACAGTTTCAATTCGGCCTTGCAGG CAGGCAGGCCGGTCACCCTGCCAGACATCACCAGTGTAGCCAAGAGCCTCGGAGCCAAGACGGTGGCTGC ACGGACCTTGGAGTGTGCAAAGGAGTGTGAGGTCCTCTCTGAGGTGGTAGAAGACCGGGAGGCTGTCAGC GCTGTGCAGAGGTTCCTGGACGATGAGCGCATGCTGGTGGAACCTGCCTGCGGTGCCGCCCTGGCCGCCA TCTACTCGGGCATCCTGTGGAGGCTCCAGGCTGAGGGCCGCCTGAGTTCTGCCCTAGCTTCCGTTGTGGT CATCGTGTGCGGTGGCAACAACATTAGTAGCCAACAGCTTCAGGAGCTGAAAATCCAGCTGGGCTGCAGC TGAAGAATCTCAGGAACTCCCCCAGAGGTTCCTGGACACCTTGGTGGGTCACTCAAGGGACCTCGGTTCC AGTGGTCCTGCCCTCTTCCTTCCAGGTAGCCCTCCTGGGTTGCTCTCAGTGGCTCCCTGCTGTCCAGTGA ATAAACCTGACTGAGCTGAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_133902
ORF Size 990 bp
Insert Size 990
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC022601, NP_598663
RefSeq Size 1223
RefSeq ORF 990
Locus ID 257635
Cytogenetics 5|5 F
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.