Ube2m (NM_145578) Mouse Untagged Clone

CAT#: MC202916

Ube2m (untagged) - Mouse ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) (Ube2m), transcript variant 1, (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ube2m (NM_145578) Mouse Untagged Clone
Symbol Ube2m
Synonyms 2510040H03Rik; Ubc-rs2; UBC12
Vector pCMV6-Kan/Neo
Sequence Data
>BC021792 sequence for NM_145578
CCGAGGATCGCCGAGTCCTCCCGAGCACCTCCGAACACACCCGAGGTGCTTAGCCAGGCCAGAGCCGGAC TACGGGAGCCGAGGCGGGCCGTGCGGTGGGCGCGGAGCAGCGCGGCAGGCCGGGCGAGCGGCAGCGGAGG AGGCCGCGGTAGCGGGTCCGAGGAGCGGAAGCGGCGCAGGCGGCGGCGGGGGGCCGGGTGGCCGGGGTCC CGGGCCCCGCGGCGGCGGCTGCGGCGGCGGCGGCAGGATGATCAAGCTGTTCTCGCTGAAGCAGCAGAAG AAGGAGGAGGAGTCGGCCGGCGGCACCAAGGGCAGCAGCAAGAAGGCGTCGGCGGCGCAGCTCCGGATTC AGAAGGACATTAACGAGCTGAACCTGCCCAAGACGTGTGACATCAGCTTCTCAGACCCAGACGACCTCCT CAACTTCAAGCTGGTGATCTGTCCTGATGAAGGCTTCTACAAAAGTGGCAAGTTTGTATTCAGCTTTAAG GTGGGACAGGGTTACCCACATGACCCTCCCAAGGTGAAGTGTGAAACAATGGTTTATCATCCCAACATTG ACCTCGAGGGCAACGTCTGCCTCAACATCCTCAGAGAGGACTGGAAGCCAGTCCTTACGATAAACTCCAT AATTTATGGCCTGCAGTATCTCTTCTTGGAGCCGAACCCTGAGGACCCACTGAACAAGGAGGCTGCTGAG GTCCTGCAGAACAACCGGCGGCTGTTTGAACAAAATGTGCAGCGCTCCATGAGAGGTGGTTACATCGGGT CCACCTACTTCGAGCGCTGCCTGAAATAGGGTTAGCAATTACCCATCCCTGCCAGGGTTACCGGCCCAGG CATCCCCTGCAAATATTTATTGGGGGCCCGGGTAAGGTGTGTGGGGTAGCCTTGGCCCCTGCCTTGGCCT TGCCTCTCTTCCCTGTCACCTGCCCCTAGTTATTTTTTTTTTTGACCACCACGTGATTATGGTCGGTGCT GCCTCCCCCCCGACCTGCTCAGCGATGGGAAATGAATTGGCTTGTTTAGCGCCCCCCCCCTCCCGCTGGG TGCTGTCCAACTCCCCACTCTTGACTGTGGGGTAAGTGGGCAATGGGCCTGGGTCGCTAGGCCCAAGCAA CCCACCCCACCACCACTGGAGGTCCCACCAGGCTATTAAAGGGGAATGTTACTGCAAAAAAAAAAAAAAA AAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_145578
ORF Size 552 bp
Insert Size 552
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC021792, NP_663553
RefSeq Size 1199
RefSeq ORF 552
Locus ID 22192
Cytogenetics 7 A1|7 7.73 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.