Capn5 (NM_007602) Mouse Untagged Clone

CAT#: MC202898

Capn5 (untagged) - Mouse calpain 5 (Capn5), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Capn5 (NM_007602) Mouse Untagged Clone
Symbol Capn5
Synonyms nCL-3
Vector pCMV6-Kan/Neo
Sequence Data
>BC014767 sequence for NM_007602
AGAGAACCTCAGTTGCTGAGGCGGGTGCTTCACTCCGTGTCCTCTTTGCCCTATAGCAGGTGCCTCCCCT TCTTGGGGACGTGGTCACCATGTTCTCCTGCGCGAAGGCCTATGAGGACCAGAACTACTCGGCGCTGAAG CGGGCCTGCCTGCGCAAGAAGGTGCTGTTCGAGGATCCCCTCTTCCCTGCCACCGACGACTCCCTTTACT ATAAGGGCACCCCAGGGCCCACAGTCAGGTGGAAGCGGCCTAAGGATATCTGCGACGATCCCCGGCTCTT CGTAGATGGCATCAGCTCCCATGACCTGCACCAGGGCCAGGTGGGCAACTGCTGGTTTGTGGCTGCCTGC TCATCACTGGCCTCCCGAGAGTCACTCTGGCAGAAGGTCATCCCAGACTGGAAGGAGCAGGAATGGAACC CCGAGAAGCCTGACAGCTATGCTGGCATCTTCCACTTCAACTTCTGGCGCTTTGGGGAGTGGGTGGACGT AATCGTCGATGACCGGCTGCCCACAGTCAACAACCAGCTCATTTACTGCCATTCCAACTCCAAAAATGAG TTCTGGTGTGCCCTGGTGGAGAAGGCCTATGCCAAGCTGGCCGGCTGTTACCAGGCCCTGGACGGAGGCA ACACGGCCGATGCATTGGTGGATTTCACAGGTGGTGTTTCTGAACCCATTGACCTGACCGAGGGGGACTT GGCCACTGACGAGGCTAAGAGGAATCAGCTCTTTGAGCGAGTGCTGAAGGTGCACAGCAGAGGCGGGCTC ATCAGTGCCTCCATCAAGGCTGTGACAGCAGCTGACATGGAGGCCCGCCTGGCATGTGGCCTGGTGAAGG GCCATGCATACGCTGTCACCGATGTGCGCAAGGTGCGCCTGGGCCATGGCCTGCTGGCCTTCTTCAAGTC AGAGAAGCTTGATATGATCCGTCTGAGGAACCCCTGGGGCGAGCGGGAGTGGACGGGGCCCTGGAGTGAC ACGTCAGAGGAATGGCAGAAAGTGAGCAAGAGTGAGAGGGAGAAGATGGGCGTGACCGTGCAGGATGATG GGGAATTCTGGATGACCTTTGAGGACATGTGCCGGTACTTTACTGACATCATTAAATGCCGCCTGATTAA CACGTCCTACCTGAGCATCCATAAGACATGGGAGGAGGCCCGGCTGCATGGTGCCTGGACGAGACATGAG GACCCACAGCAGAACCGCAGTGGAGGCTGCATCAACCACAAGGACACTTTCTTCCAGAACCCACAGTACG TATTTGAAGTCAAGAAGCCAGAAGATGAAGTGTTGATCAGTATCCAGCAGCGGCCGAAGCGCTCAACTCG CCGGGAGGGCAAAGGCGAGAATCTGGCCATTGGCTTCAACATCTATAAGGTGGAAGAGAACCGCCAATAC CGTATGCACAGCCTACAGCATAAGGCCGCCAGCTCCATCTACATCAATTCCCGCAGCGTTTTTTTGAGGA CAGAGCTGCCCGAGGGCCGCTACGTTATCATCCCTACCACCTTTGAGCCAGGCCACACTGGCGAGTTCCT GCTCCGAGTCTTCACAGATGTCCCCTCCAACTGCCGGGAACTACGCCTGGATGAGCCCCCTCGGACCTGT TGGAGTTCCCTCTGTGGCTACCCTCAGCAGGTGGCCCAGGTACATGTCCTGGGGGCTGCTGGCCTCAAGG ACTCCCCAACAGGAGCAAACTCATATGTGATCATCAAGTGTGAGGGCGAAAAGGTTCGCTCAGCTGTGCA GAGAGGGACCTCGACACCAGAGTACAATGTAAAAGGCATCTTCTATCGCAAGAAGCTGGCTCAGCCTATC ACCGTGCAGGTTTGGAATCACCGAGTCCTGAAGGATGAATTCCTGGGCCAGGTGCACCTGAAGACTGCCC CGGATGACCTGCAGGACCTCCACACCCTCCATCTCCAGGACCGCAGTAGCCGGCAGCCCAGTGACCTGCC AGGCATTGTAGCTGTGCGAGTCCTCTGCAGTGCCTCTCTCACGGCTGTCTGACCCCAGCCTGCCTGTCCT GCCCCACTAGTCCTCACCACTCTTCGCATGTCCCCACCTTGCCTGGGACCAGCCTGGGAACCAGACACTG GGGCCCTTTCCTCACTCTTCCACTGACCCACTGTGTGACCTGAAGAGAGCCCTGCCCTCTCGGAGCCTCA GTGTTTGGAGGGCCCCAAAGAATTCCCGTCTTGTGGGGGAGTTTTCTTGCCTAAAGAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_007602
ORF Size 1923 bp
Insert Size 1923
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC014767, NP_031628
RefSeq Size 2240
RefSeq ORF 1923
Locus ID 12337
Cytogenetics 7|7 E1
Gene Summary The protein encoded by this gene is a member of the calpain family of proteins. Unlike many members of the calpain gene family, this gene lacks a calmodulin-like domain, required for calcium binding. Mouse models for Huntington's disease displayed increased levels of the protein encoded by this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.