Mterf1a (NM_001013023) Mouse Untagged Clone

CAT#: MC202791

Mterf (untagged) - Mouse mitochondrial transcription termination factor (Mterf), nuclear gene encoding mitochondrial protein, transcript variant 1, (10ug)


  "NM_001013023" in other vectors (3)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
MTERF Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Mterf1a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Mterf1a
Synonyms 4931431L11Rik; 9230106K09Rik; Mterf; Mterf1; mTERF1b
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC082778 sequence for NM_001013023
GGGCGGAAGTGAAAGGTGTCTACCGCGAGTGTTGCATTTGAAAAACTTTGGGCTACCTGATGATTATGGC ATCAAGAAACATCTGGTGTGTGAGAAGAAACTTTCTCTTTGATTTAAGAGGCTGGATGCTTCAATATTCA GCAGAAGTTTTCCTCAAGTCGATTTCATTCAGGCCGTTTAGTGTGGAATGCGACAGTAAGGACAAGGAGT CTTTGGAGGAGGAGAGGGAGGACCTGCTGAGCAACTTAGTCACCATGGGCGTTGATATCGACATGGCAAG GAGGCGACAGCCTGGAGTTTTTAACAAGGCTGTTACGAATGAGCAGGAGCTGAAGATATTTCTTCTGTCC AAGGGAGCTAGTGACAAAGTGATTGGTAGCATCATATCAAGATATCCACGAGCTATAACACGCACTCCTG AAAGTCTTTCAAAACGGTGGCATCTGTGGAGAAAGATTATGGCATCAGACCTTGAAATTGTAAATATTTT GGAGCGTTCTCCTGAATCCTTTTTTCGATCTAATAACAATCTAAACTTAGAGAATAATATAAAGTTCCTT TGCTCTGTTGGATTGACTCATAAATGCCTCTGCCGACTGTTGACCAATGCTCCCAGAACCTTCTCCAACA GTCTGAATTTGAATAAGCAAATGGTTGAATTTTTGCAGGAGACTGGTATGTCCTTAGGTCACAATGATCC CAGAGATTTTGTCAGAAAGATAATTTCTAAAAACCCTTCCATCTTAATTCAGAGCACCAAGCGTGTAAAA ACTAACATTGAATTTTTACAATCAACTTTCAACTTGAACAAACGGGACCTGCTGCTTCTGATATGTGGCC CAGGAGCTAGAATCTTAGACCTTTCCAATGACTGTACCAAAAAAAATTACACAAACATAAGAGAGAGGCT GCTTTCTCTTGGATGCAGTGAGGAGGAGGTACAGAGGTTTGTCCTAAGCTATCTGAATATGGTCTTCTTG TCAGAGAAAAAGTTTAATGATAAAATAGACTGCCTTATAGAAGAAAAAATCAGTGCTTCACAAATAATTG AAAATCCGAGGATTTTAGACTCCAGCATAAATACTTTAAAAACTCGCATCCGAGAGCTGTCCCATGCTGG GTATGACTTGAGCACATCCAGCATTGCTCTGCTGTCCTGGAGTCAGAGAAGATATGAAGCTAAACTGAAG AGATTATGTGGATAGGACAGTGCAGGAGGAGTAGCAGGCAATCTGACAGGTGTGGCACTGGTTCCAGTTT GGACTTTTCAAGCAGGAGAGTTTTGTTTTTGTTTTTTAATTATTTTTTTTTAATTTTTTAAATAAAAATT TAAAAATATTTAAGATTAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_001013023
Insert Size 1140 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC082778, AAH82778
RefSeq Size 1372 bp
RefSeq ORF 1140 bp
Locus ID 545725
UniProt ID Q8CHZ9
Cytogenetics 5 A1
Gene Summary Transcription termination factor. Binds to a 28 bp region within the tRNA(Leu(uur)) gene at a position immediately adjacent to and downstream of the 16S rRNA gene; this region comprises a tridecamer sequence critical for directing accurate termination. Binds DNA along the major grove and promotes DNA bending and partial unwinding. Promotes base flipping. Transcription termination activity appears to be polarized with highest specificity for transcripts initiated on the light strand.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.