Tfam (NM_009360) Mouse Untagged Clone

CAT#: MC202747

Tfam (untagged) - Mouse transcription factor A, mitochondrial (Tfam), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_009360" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-Tfam Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Tfam"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tfam
Synonyms AI661103; Hmgts; mtTFA; tsHMG
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC083084 sequence for NM_009360
GCCCCCGGAGTTCCCACGCTGGTAGTGTGGCAGTCCATAGGCACCGTATTGCGTGAGACGAACCGGACGG CGCCGGGCCATCATTCGTCGGCCCGAGCGATGGCGCTGTTCCGGGGAATGTGGAGCGTGCTAAAAGCACT GGGGCGCACGGGGGTCGAGATGTGCGCGGGCTGCGGGGGTCGCATCCCCTCGTCTATCAGTCTTGTCTGT ATTCCGAAGTGTTTTTCCAGCATGGGTAGCTATCCAAAGAAACCTATGAGTTCATACCTTCGATTTTCCA CAGAACAGCTACCCAAATTTAAAGCTAAACACCCAGATGCAAAACTTTCAGAATTGGTTAGGAAAATTGC AGCCCTGTGGAGGGAGCTACCAGAAGCAGAAAAAAAGGTTTATGAAGCTGATTTTAAAGCTGAGTGGAAA GCATACAAAGAAGCTGTGAGCAAGTATAAAGAGCAGCTAACTCCAAGTCAGCTGATGGGTATGGAGAAGG AGGCCCGGCAGAGACGGTTAAAAAAGAAAGCACTGGTAAAGAGAAGAGAATTAATTTTGCTTGGAAAACC AAAAAGACCTCGTTCAGCATATAACATTTATGTATCTGAAAGCTTCCAGGAGGCAAAGGATGATTCGGCT CAGGGAAAATTGAAGCTTGTAAATGAGGCTTGGAAAAATCTGTCTCCTGAGGAAAAGCAGGCATATATTC AGCTTGCTAAAGATGATAGGATTCGTTACGACAATGAAATGAAGTCTTGGGAAGAGCAGATGGCTGAAGT TGGACGAAGTGATCTCATCCGTCGAAGTGTGAAACGATCCGGAGACATCTCTGAGCATTAAGATGGAAGA CGGAGTTGTCATTGGGATTAGGCCCAAGAAACCAGTTAGGTCTCAAAGCCTTAAAGTGTCAAACTAGAAC GGATAAAGGTGGTTAACCTTTGACATTCAGATCATTTTTCTGTAGCCATGGACTTTCTGTTAATACTTTG AGCCTTGACAGAAGATGATGCTGAGTTCTGCCTTTTGCTTAAGAACTGGAACGGAGACTGTCCATGCATC TGCATGCAGTGGTGAATCATTCTGCATTTGATGGGCTAGATAGACTGTGAAGTGACTTTCACACTGGTGA CAGTTGTGTGGTGGTTTTGTGATGTTTTTACACTGATGACCGTTACATATGGGTGTGGCCCTTGGGTCCC AGGCCGGACCTGCTCTCCCAGCTGTGGCAGAGCTGTGGATAACTGCATTTTCAAAGAAGCTGCCAGGCTT TCCTAGATGAAATGATTCCTAGACATAAATCATGTGTAAGTTGATGTTTGTATATAATAAGCGATTGCTG ATGTCCTGATAGCATTTTATAGTAGTAACAGAGAGATTTACACATCTTTCTCAAATTAAGAAATTATGTA CCAAGTCTATGCATAGGTTTTTCTTGCATAGAATAAAAACTCTAATTTTCCAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_009360
Insert Size 732 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC083084, AAH83084
RefSeq Size 1466 bp
RefSeq ORF 732 bp
Locus ID 21780
UniProt ID P40630
Cytogenetics 10 36.83 cM
Gene Summary Isoform Mitochondrial binds to the mitochondrial light strand promoter and functions in mitochondrial transcription regulation. Required for accurate and efficient promoter recognition by the mitochondrial RNA polymerase. Promotes transcription initiation from the HSP1 and the light strand promoter by binding immediately upstream of transcriptional start sites. Is able to unwind DNA. Bends the mitochondrial light strand promoter DNA into a U-turn shape via its HMG boxes. Required for maintenance of normal levels of mitochondrial DNA. May play a role in organizing and compacting mitochondrial DNA. Isoform Nuclear may also function as a transcriptional activator or may have a structural role in the compaction of nuclear DNA during spermatogenesis.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.