Slc3a2 (NM_008577) Mouse Untagged Clone

CAT#: MC202720

Slc3a2 (untagged) - Mouse solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 (Slc3a2), transcript variant 2, (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Slc3a2 (NM_008577) Mouse Untagged Clone
Symbol Slc3a2
Synonyms 4F2; 4F2HC; AI314110; Cd98; Ly-10; Ly-m10; Ly10; Mdu1; Mgp-2hc; NACAE
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC065173 sequence for NM_008577
GCTCTGCTAGCCTCACGGCCACGGGACGCCTCTCTGAACGGGGATCCAGGCAGGATTAGAGCTGCCTCAC TGACTACAGGCCGTGTCGTGTCACCGTTTCTGCAGGCACCATGAGCCAGGACACCGAAGTGGACATGAAA GATGTGGAGCTGAACGAGCTAGAACCGGAGAAGCAGCCCATGAATGCAGCGGACGGGGCGGCGGCCGGGG AGAAGAACGGTCTGGTGAAGATCAAGGTGGCGGAGGACGAGACGGAGGCCGGGGTCAAGTTCACCGGCTT ATCCAAGGAGGAGCTACTGAAGGTAGCGGGCAGCCCTGGCTGGGTGCGCACCCGCTGGGCGCTGCTGCTG CTCTTCTGGCTCGGTTGGCTGGGCATGCTGGCGGGCGCCGTGGTTATCATCGTTCGGGCGCCGCGCTGCC GTGAGCTGCCTGTACAGAGGTGGTGGCACAAGGGCGCCCTCTACCGCATCGGCGACCTTCAGGCCTTTGT AGGCCGGGATGCGGGAGGCATAGCTGGTCTGAAGAGCCATCTGGAGTACTTGAGCACCCTGAAGGTGAAG GGCCTGGTGTTAGGCCCAATTCACAAGAACCAGAAGGATGAAATCAATGAAACCGACCTGAAACAGATTA ATCCCACTTTGGGCTCCCAGGAAGATTTTAAAGACCTTCTACAAAGTGCCAAGAAAAAGAGCATTCACAT CATTTTGGACCTCACTCCCAACTACCAGGGCCAGAATGCGTGGTTCCTCCCTGCTCAGGCTGACATTGTA GCCACCAAAATGAAGGAAGCTCTGAGTTCTTGGTTGCAGGACGGTGTGGATGGTTTCCAATTCCGGGATG TGGGAAAGCTGATGAATGCACCCTTGTACTTGGCTGAGTGGCAGAATATCACCAAGAACTTAAGTGAGGA CAGGCTTTTGATTGCAGGGACTGAGTCCTCTGACCTGCAGCAAATTGTCAACATACTTGAATCCACCAGC GACCTGCTGTTGACCAGCTCCTACCTGTCAAATTCCACTTTCACTGGGGAGCGTACTGAATCCCTAGTCA CTAGGTTTTTGAATGCCACTGGCAGCCAATGGTGCAGCTGGAGTGTGTCGCAAGCAGGACTCCTCGCAGA CTTTATACCGGACCATCTTCTCCGACTCTACCAGCTGCTGCTCTTCACTCTGCCAGGGACTCCTGTTTTT AGCTACGGGGATGAGCTTGGCCTTCAGGGTGCCCTTCCTGGACAGCCTGCGAAGGCCCCACTCATGCCGT GGAATGAGTCCAGCATCTTTCACATCCCAAGACCTGTAAGCCTCAACATGACAGTGAAGGGCCAGAATGA AGACCCTGGCTCCCTCCTTACCCAGTTCCGGCGGCTGAGTGACCTTCGGGGTAAGGAGCGCTCTCTGTTG CACGGTGACTTCCATGCACTGTCTTCCTCACCTGACCTCTTCTCCTACATACGACACTGGGACCAGAATG AGCGTTACCTGGTGGTGCTCAACTTCCGAGATTCGGGCCGGTCAGCCAGGCTAGGGGCCTCCAACCTCCC TGCTGGCATAAGCCTGCCAGCCAGCGCTAAACTTTTGCTTAGTACCGACAGTGCCCGGCAAAGCCGTGAG GAGGACACCTCCCTGAAGCTGGAAAACCTGAGCCTGAATCCTTATGAGGGCTTGCTGTTACAGTTCCCCT TTGTGGCCTGATCCTTCCTATGCAGAACCTACCACCCTCCTTTGTTCTCCCCAGGCCTTTTGGATTCTAG TCTTCCTCTCCTTGTTTTTAAACTTTTGCAGATTACATACGAATTCTTATACTGGGTGTTTTTGTCTTCA AATAAAAACATCACCCCTGCCTCATGAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
Tag Tag Free
ACCN NM_008577
ORF Size 1581 bp
Insert Size 1581
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC065173, NP_032603
RefSeq Size 1866
RefSeq ORF 1581
Locus ID 17254
Cytogenetics 19 A|19 5.44 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.