Rab2a (NM_021518) Mouse Untagged Clone

CAT#: MC202714

Rab2a (untagged) - Mouse RAB2A, member RAS oncogene family (Rab2a), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Rab2a (NM_021518) Mouse Untagged Clone
Symbol Rab2a
Synonyms 9330148M11Rik; C80220; Rab2
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC058382 sequence for NM_021518
GGCGCCGCGGCTGTTATTGTTCCGAAGGGCTGGGCCGCTGTGCTCCGCGCTCGGCGCTGTCAGTTCGTCC CGCTGCCCCTCGGCCTTTGCTGCTGGCTCTGACGGCGACCGACGGCGGGCGGGGCCCGGGTTCGCGGCCG AGCGGCGCCGGTGAGGGCGCGGAGGAGGCGCACAGCGGGAGGAGGAGCCGTGAGCCTGGCACGGAGCGGC CGCGGCCATGGCGTACGCCTATCTCTTCAAGTACATCATCATCGGCGACACAGGTGTTGGTAAATCGTGC TTATTGCTACAGTTTACAGACAAGAGGTTTCAGCCGGTGCATGACCTCACAATTGGTGTAGAGTTTGGTG CTCGGATGATAACGATTGATGGGAAACAGATAAAACTCCAGATCTGGGATACAGCAGGGCAGGAGTCCTT TCGTTCTATCACACGGTCATATTACAGAGGTGCAGCGGGGGCTTTACTAGTGTATGATATTACAAGGAGA GACACGTTCAACCACTTGACAACCTGGTTAGAAGATGCCCGTCAGCATTCCAATTCCAACATGGTCATCA TGCTTATTGGAAATAAAAGTGACTTAGAATCTAGGAGAGAAGTGAAAAAGGAAGAAGGTGAAGCTTTTGC ACGAGAGCATGGACTTATCTTCATGGAAACTTCTGCCAAGACTGCGTCTAATGTAGAAAAGGCATTTATT AACACAGCAAAAGAAATTTATGAAAAAATCCAAGAAGGGGTCTTTGACATTAATAATGAGGCAAACGGCA TTAAAATTGGCCCTCAGCACGCTGCTACCAACGCATCTCATGGAAGCAACCAAGGCGGACAGCAGGCAGG GGGAGGCTGCTGTTGAGTCTGGTGTTACCGGCTAGCTGCCCAGTGGAGCCACGCACTCTGTCACCCTCTT TCCTCATGCTCAGCTGAGACATGAAACTATTGAAATGGCTTTATGTCACAGGAGACTTTAATCCTTCAGA TTCTTGTATAACTTTGAATAAATGGTTAATGTTCACTTAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
Tag Tag Free
ACCN NM_021518
ORF Size 639 bp
Insert Size 639
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC058382, NP_067493
RefSeq Size 1042
RefSeq ORF 639
Locus ID 59021
Cytogenetics 4|4 A1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.