Rhoq (NM_145491) Mouse Untagged Clone

CAT#: MC202655

Rhoq (untagged) - Mouse ras homolog gene family, member Q (Rhoq), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Rhoq (NM_145491) Mouse Untagged Clone
Symbol Rhoq
Synonyms Arhq; Tc10; TC10A
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC056363 sequence for NM_145491
CGCACGGCGGGCGCGGGCGCGGGGCGCGCCGCACTCCGGAGCCGCCCGGACCGCCCTCCCCCACCCCCCT TCACCGGCCCAGGAGGGCGGGGGCCGGAGCGGCGCGGGGCGGGCAGAGCCGCCTGGCCCCTCCCCTCCGC CGCCCTCCCCAAAGTTGCCGACTCCCCTGGGGCCGGACGGTCTTATGATCCGGCGGATCCTCCTGGGGAG GCCGGGCCGGGGAGCGGGTTCGGGCGCCGAGCGGCGGGGCCAGCAGGCGGGCGCGGCGAGCCGGGCCAGG GCGGGGAGCGGGGCAGAGATCGAAGCGGCGGCGGCTGCGCCCCGGGCCCGCCGCACCTTCTCCTCCGGTC AGGGGAACCGCTGCATGGGGCCGGGAGGGCGGCCCTGCTGCGCCGAGCGGCGGCGACGGCGGACCCCCCA AGCGGGCTGGGGCTGAGCCCGGGGCCAGGGCGGGGGCTCCGGGGGGACCATGCCCCGAGGCCGGCCGGCC GCAGCATGGCTCACGGGCCCGGCGCGCTGATGCTGAAGTGCGTGGTGGTCGGCGACGGGGCGGTGGGCAA GACGTGCCTGCTCATGAGCTATGCCAACGACGCCTTCCCCGAGGAGTACGTGCCCACTGTCTTCGACCAC TACGCAGTCAGCGTCACCGTGGGGGGCAAGCAGTACCTCTTGGGACTCTATGACACAGCTGGACAGGAAG ACTATGATCGTCTGAGGCCTTTATCTTACCCCATGACTGACGTCTTCCTCATATGCTTCTCCGTGGTAAA TCCAGCCTCGTTTCAAAATGTAAAGGAAGAGTGGGTACCAGAGCTAAAGGAATATGCGCCAAACGTCCCC TTCTTGTTAATAGGAACTCAGATTGATCTCCGAGATGACCCCAAAACTTTAGCAAGACTGAATGACATGA AAGAAAAACCTGTCTGTGTGGAACAAGGACAGAAACTAGCAAAAGAGATAGGTGCATGCTGCTATGTGGA GTGTTCAGCTTTAACCCAGAAGGGTTTGAAGACTGTGTTTGATGAGGCTATCATAGCCATTTTAACTCCA AAGAAACACACAGTAAAAAAAAGAATAGGATCAAGATGTATAAACTGTTGTTTGATTACGTGAGAAACAT CTTTAGTGGCCAAGGAAACTGTCCATTTCTCCCAGAAAGCATTTGAAATGCTACAGCGCTATCCTGACCT CTTACAGTGAAGCAGTTTAACTTGAGGAGGGAGGGAACCTGTCCTCAGCATTCTACAGAGTTCATTGAGA ATGTTTCAGAAAGGTCTAAGCGGCAGCGAACAGCATCTGAAGCCACAATCTACTATAAATACTTTATTTC AACTAGAAGGTACAATCTCTCAGGGGTTTCATAGTTAAAAAGCTACAATCACATCATGTTGAAATGACAT TTAGAAAACAACAGTGCTGTAAATGGACTGCCCGGCTTGGACCATGTAACTTCTGCACAGCCCTTATGGA ATCTGCACAGAGAAATAACTTCTCTCCTTTCTCCTCTTAATTGTTCTTGTATGTAAGCTGCTTTCTATTC CAGTAGATCCAGAGTGGCGAGATAACCAGGCCAGCCACGTAGCCAAAGGTCGCTCCGAGTGTACAGGAGA TGGGCCACACCTGAGGAAAGAATTGAGATCTAAACCAACCGATGCTTTATTATACTTGAGCACAAATGAA GTGTAACACAAACCTTTCTATAGTGAAGCTTAGTGTGCTTTCTTAAAGAATGCCAAGTTGAATAGATCAT AACTGCTTTGATCATGAACACTAAAAATGTACACATTTTAGTTAATGTGCATTAAACAGTAACAAGGCTT CTGGCAACTGTAGATTTTAGTTTGATGTTATCCAAATTGCATGAAATACATGCTAAAGTAACGTTTAAAA ATTGGGTCATAGTTTGCCATAATCCTGAACTCAGTTTAGCTCTCTGAATTAGTTGGCCATTTTCTAATTC CCACATTGGCTGTATACATCAAATGAAGTAAGTGTATAGGCTGACCGATTCTCAGAAACTCTCAGTCGTG TCAGAGGGAAGACCTGGAATCTAAGCGCGTCCTGTGGGATTTGTGGATATCTGCTTCCATAGTAAAACTG ATGTCCGCTTGGAGCTGCAGCTAGCACATCCACAGCAGAAGGCACAACCCACAGCTTACGCACACACCTA GTGAGAGGCGAGCAGAGCACTGCTGCCTTCCCAAGACCCTTCCTCCAGCCACGCTACATTTCACTAAGCC AGAGATAATAATGGTGACTTTTCTTTGTAATGCCACAGACAGGGTATGTGTGGAACGTCTTGGAAACAAA CTTTCATGCTCCTTTGTAAAGCTTATTTGGTGTACCGCAGCCATTTCTAACCCTTCTCCGGGGAATAGGC CATCAAAGTGTACTGCAGGCAAACCATCTTACTAACTGGCTGGAACCTCATTTGGCTTTCTTCTTCGGTC TGCTATGGATCTGCCTTATTCTAAATGCCATGCAACAGACAGTAGTGTAGACAAAGCTCCCATGGGAACC ACCTCCTGCAGTGGAGGGAAGCAGATTCTAACCCAGGCATTCTTACCAGCCTTCTTTAGGTTCAAATTTG CAGTTGCTTAAACTACGACTTGTCTTTAGCAAGCTTCTGTTATCTTCCATGGTTTGTGCTTAAGCTTTGT GTATTGCACAGATTGGGTAATGGAACACTAAACATTTATACTTGAAAATGACAGCCTTAAATGTTCATAC CAGTCACAAATCTAGATGTACTGTCTTGCATGTGAGCTTTGTAGGAGTTTTTAAAATATAAGCACCACAC TCCCCACTTGGTAGTGGACAGTCTACTGGACAAGAGTGTTCTCCTGGAAGTGGGCACAGTATGTCTTCAG GCAGTGGTGGTTCACATTAAGTATATCATGGCCTTATGTATGCTCAAATGGGACTTCTGTAATTTTCCCA TTTAGTTTTGGTCTGTTTTTAGATAGAATTGGAAGAAACTGTATAGTTAACATGAGCTAAGTTGTCAAAC CTATGATCTGAAGGAACCAAGACAGTAAAGTATTATTCGTTTCCAAGTTGCCTGTGGAGATTTGATGGCT TGTTCTTTTCTTCAAATCCACATCTGTGAAACCCTTGACACTTGGTGTTGGCAATGAGTTTAAGTCAAGG ACTTTCCTGCTCCAAGAGAAACGGATTCAGAATCTGAACGTGCACTGGTGTCACCTCAGTCTCCTCATGT TTGATCACGGGGACAACCTCTTGTCCCAGTCATTCATGAGCTCTGAGCACTCTCCTCCGACTGACAGCAG TCATGGCTGGCCTCCACCTTCTCCAGATGGTAAGACCTTGTACATAGACCACGTGAACTCTCGCAGACGG CTGCATCACCCGAACCTGAGGTGCCTTAGGTGCTCTATTTACCTGGATGGGGCTCGGAGTTTCCCATTGC TTGTTAAGAGCTCTTTGTGTTTGTTATTTAGTATTTCTTTTTGCAAAACCTTCTCTGCCACTTTAACCAG AAAACCAAAGATTTGTTTTCTATTCATGAGCAGATTATAGAGACACTGCCTTATTTTCAGACGCATATAG CTTCATTAATGGCTTAGGTTGCAGAAGAAATTCAGACTAGTCTCTGAAATAACTCTTTCAAACTAGTGAA ATATCTGGGAAAGAAAATACTTTTCAAAAATATTTTATTAACATGAACTGTGTTAGTGAGCACACTGCTT CAAATAAGGTCATGTGTGAAAGAACATTCAGAAAGTTATAATTGGTTAGTGTTTGCATAGAAAATTTGTT CTAAAGCCCTTTAAAATTTTTAGGGAAATCTTGAAATCTTACAGCACTTACTTTGCTAATGTATGCCCTT ATCTGTCCTTACAGGTACACGTAGCTTCCTCGTGGTGATTTATCATATTACATACGTAGAGCTTGAGTTC ATGCTATTTGTTATAAATTATCTTAGTTACTTTAGACACTGCTTCCGTTTGATTTTTAATTATTGGTTTT AAATACCAAATTAAATGCTGGTTTGTTGGTTGTTGTTTTTAAATGATTGTTCCTTCAACAGCATCCCCTC CTGACGGATGGGGTCATAATAAAATGAGATGCGTAGTTTACTGTTTTATGTAAAGCACTGGAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
Tag Tag Free
ACCN NM_145491
ORF Size 618 bp
Insert Size 618
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC056363, NP_663466
RefSeq Size 4159
RefSeq ORF 618
Locus ID 104215
Cytogenetics 17 E4|17 56.9 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.