Fabp7 (NM_021272) Mouse Untagged Clone

CAT#: MC202484

Fabp7 (untagged) - Mouse fatty acid binding protein 7, brain (Fabp7), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fabp7
• Synonyms: B-FABP; BFABP; Blbp; MRG
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC057090 sequence for NM_021272
  TGAATTACGGTGGTGGGTAAGACCCGAGTTCCTCCAGTTCCTGCCTATTTTCAGCTGACTAGGCGGTTAA GGATGGTAGATGCTTTCTGCGCAACCTGGAAGCTGACAGACAGTCAGAATTTTGATGAGTACATGAAAGC TCTGGGCGTGGGCTTTGCCACTAGGCAAGTGGGAAACGTGACCAAACCAACTGTGATTATCAGTCAGGAA GGTGGCAAAGTGGTGATCCGGACACAATGCACATTCAAGAACACAGAGATCAATTTCCAGCTGGGAGAAG AGTTTGAAGAAACCAGCATAGATGACAGAAACTGTAAGTCTGTGGTTCGGTTGGATGGAGACAAGCTCAT TCATGTGCAGAAGTGGGATGGCAAAGAAACAAATTGTACCAGAGAAATTAAGGATGGCAAGATGGTCGTG ACTCTTACCTTTGGGGATATCGTTGCTGTTCGCTGTTATGAAAAGGCATAGAAGAGATGACAGGACTTTT GACAACTTGGTTTCCTGGAGTCCCAGAGTTAGCCAGCTAATGAAGCACTGGTCACTAATTATAAGTTTGT CTTCGGTGTGGAGGTAGAAAATTATAATTCTAAGATGTGTTACTCCAAGCAATTCATGGGATTTTGATAT GCAAATTTACTGTTTTCCATTTTTTTTAAATAATTTTACAATACTTTTTATAGAAATGGGAATATACTTA TGACTTTCTTTGGAATGCAAACCAAATTGAAATAAAAAATACACACACAAAAAAAAAAAAAAAAAAAAAA AAAAAA
• Restriction Sites: AscI-NotI
• ACCN: NM_021272
• Insert Size: 399 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC057090, AAH57090
• RefSeq Size: 776 bp
• RefSeq ORF: 399 bp
• Locus ID: 12140
• UniProt ID: P51880
• Cytogenetics: 10 B4
• Gene Summary: B-FABP could be involved in the transport of a so far unknown hydrophobic ligand with potential morphogenic activity during CNS development. It is required for the establishment of the radial glial fiber system in developing brain, a system that is necessary for the migration of immature neurons to establish cortical layers.[UniProtKB/Swiss-Prot Function]