Nrtn (NM_008738) Mouse Untagged Clone

CAT#: MC202337

Nrtn (untagged) - Mouse neurturin (Nrtn), (10ug)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Nrtn (NM_008738) Mouse Untagged Clone
Symbol Nrtn
Synonyms NTN
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC057993 sequence for NM_008738
GCTTCGTCCGTGTGCCCCGCGCCCGGCGCTCCTCGCGTGGCCCCGCGTCCTGAGCGCGCTCCAGCCTCCC ACGCGCGCCACCCCGGGGTTCACTGAGCCCGGCGAGCCCGGGGAAGACAGAGAAAGAGAGGCCAGGGGGG GAACCCCATGGCCCGGCCCGTGTCCCGCACCCTGTGCGGTGGCCTCCTCCGGCACGGGGTCCCCGGGTCG CCTCCGGTCCCCGCGATCCGGATGGCGCACGCAGTGGCTGGGGCCGGGCCGGGCTCGGGTGGTCGGAGGA GTCACCACTGACCGGGTCATCTGGAGCCCGTGGCAGGCCGAGGCCCAGGATGAGGCGCTGGAAGGCAGCG GCCCTGGTGTCGCTCATCTGCAGCTCCCTGCTATCTGTCTGGATGTGCCAGGAGGGTCTGCTCTTGGGCC ACCGCCTGGGACCCGCGCTTGCCCCGCTACGACGCCCTCCACGCACCCTGGACGCCCGCATCGCCCGCCT GGCCCAGTATCGCGCTCTGCTCCAGGGCGCCCCCGACGCGGTGGAGCTTCGAGAACTTTCTCCCTGGGCT GCCCGCATCCCGGGACCGCGCCGTCGAGCGGGTCCCCGGCGTCGGCGGGCGCGGCCGGGGGCTCGGCCTT GTGGGCTGCGCGAGCTCGAGGTGCGCGTGAGCGAGCTGGGCCTGGGCTACACGTCGGATGAGACCGTGCT GTTCCGCTACTGCGCAGGCGCGTGCGAGGCGGCCATCCGCATCTACGACCTGGGCCTTCGGCGCCTGCGC CAGCGGAGGCGCGTGCGCAGAGAGCGGGCGCGGGCGCACCCGTGTTGTCGCCCGACGGCCTATGAGGACG AGGTGTCCTTCCTGGACGTGCACAGCCGCTACCACACGCTGCAAGAGCTGTCGGCGCGGGAGTGCGCGTG CGTGTGATGCTACCTCACGCCCCCCGACCTGCGAAAGGGCCCTCCCTGCCGACCCTCGCTGAGAACTGAC TTCACATAAAGTGTGGGAACTCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_008738
ORF Size 588 bp
Insert Size 588
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC057993, NP_032764
RefSeq Size 1064
RefSeq ORF 588
Locus ID 18188
Cytogenetics 17 D|17 29.49 cM
Gene Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein signals through the RET receptor tyrosine kinase and a GPI-linked coreceptor, and promotes survival of neuronal populations. Homozygous knockout mice for this gene exhibit defects in the development of the retina and enteric nervous system, and reduced cholinergic innervation of the heart and lacrimal glands. [provided by RefSeq, Aug 2016].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.