Vamp1 (NM_009496) Mouse Untagged Clone

CAT#: MC202306

Vamp1 (untagged) - Mouse vesicle-associated membrane protein 1 (Vamp1), transcript variant 1, (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Vamp1 (NM_009496) Mouse Untagged Clone
Symbol Vamp1
Synonyms lew; Syb-1; Syb1; VAMP-1
Vector pCMV6-Kan/Neo
Sequence Data
>BC049902 sequence for NM_009496
GTGAGGCGGCGCTCGACAGTTCCGTCTGCTTCAGCCGCAGTGTCTCCCTGCCCGTCTCGTTGCATTCTCC AGAGAGGGGACGGACCTCCACTTCCTCTTTCAGAAAAATGTCTGCTCCAGCTCAACCGCCTGCTGAAGGG ACAGAAGGAGCTGCCCCTGGTGGGGGTCCTCCTGGTCCTCCTCCCAACATGACCAGTAACAGGCGGTTAC AGCAGACCCAGGCACAAGTGGAGGAGGTGGTGGACATCATGCGTGTGAATGTGGACAAGGTCTTGGAGAG GGACCAGAAGTTGTCAGAGCTGGATGACCGGGCTGACGCCTTGCAGGCCGGAGCATCACAATTTGAGAGC AGTGCTGCCAAGCTAAAAAGGAAGTACTGGTGGAAAAACTGCAAGATGATGATCATGCTGGGAGCTATCT GTGCCATCATCGTGGTAGTGATTGTAATCTACTTTTTTACTTGAGAATGTGCCATCCCTTCCCTGTTCTC CATTGCCACCCAAGCTCATGTCTCTTCCCCTCTGTTTGCTTTCTCAACAAACTCCTCCATCCTCCGTTCT CCATCCTGGCCCAGGCTTCTCCATGACCCTTCCTTTACTGTTGCGTTCATTTGCACCCTTCCTCAAAACT AGAAATGCTGCTCGTGGTCCAGTCCTGAAGTCACTACCCGAAGACAACGGCTGGCACCTCCTCCTTACCC ATTTATCGTGTGCCTGGAGCTTAAAAGAGTTGTGGCCAAAGGGAAGGAGGGGGCCGGGAATGGCAGAGGT GAAGTGTCTGAGAAGTTAGCATAGCTGAGGGGAGGAGAAGGGTATTTGTGTCCATGGTGTCTCCAAGAAA GGCTGGCCTTTGGCAGGAGGGGAGCAAGAATAGTTGGGAAGTAGTAGCTTGCTGCCAGTGCATGTGTATA TGCACATGTATATGTACATGCACATGTATATGTATATATTAGTTGGGAACTGTTGTCCTTATTTGAAACT TTTCTCCCATACCAGGCCTGCCTTTGGTCCCAGAGGTCTGTTTAAAGACCAACTTCAAATCCCTTTTAGA AAAAGTCAGACTTGTATTTTGTAGCTACTCTTTACATGTCAGTACAGGATTTTCTGTGTCTGTGGGGAAC TTTACAGCCTTTCGCTCGCTTTGTTCTCTGTAGGCCTAGGAAAGGCGTACTTTCTGGTTGTAAAAACACC AGGACACTCTTACCTTCTCCTAGAAGCCATCCCACATGCTTCTCTTCATGTCACCTGAAGCATTTGATGT TATTCATGAAGGCACCAAATAATTTCAGGGAATCAGGGGCTTGGAAAATAACAAGCTTTCAGGAGTGTGC TTCTTGCCATCTCACTAATGAAAGGCCTGTCCCTCCCTTGTTGTTGATCACGAGAAATGAGAGCTGCATG GCAAGACTCCCAGGCTGCCACAGAACACTTTCCTCCACACTACCCTGTATGTAACACGGGGGGAGGCAGG AGGGCCTTTCCAGAGTTAGAGAAGTCCACTGATCCCGCAGCTCAGTTTTGGATAGGAGGGTCCAGGCTGT GTTGGTGTGCCGTTGCGCTGCTGTGCGGCATGGGCCTCGCATCCGCAGCTGCCTGCCACTCTTCCGTTAG TTCTCCCTGCAGCCGCTGTGCCCATCCATTCTGCATTGCCTCCTGTCTTTCACTCCCTTTGCATGCTGTG TTTGTTGGAGCCGAGGATAGGAGCTGCACAGTCTGTCTCGGGGGCTTCTTCTAGTGTCATGATAGGATCC CGCATGGGACAAAGCCAGGTGCCCGGCGGGTGGAGGGCAGGGTGGGAAGAGGAGGGCAATGTTCTCAGAC CTCTATTCCTTCTGTGCTCTGGTCCACAAACTGGAGGAGGCAGGGCCGTGCTAGGCCGGGGGTCCACTTC CCACGCAGCAGCCTTTCGTTCTGCAGAGCCATCGATCCTTCCTTTCCCTTGGCCCATTTTCCACCTTCCC TTCGTGCTGCCTCAGGGCAGGGCTGAAGAGCTGGAAGAAAGCAGTCAGTGTAGCCTCCCAATGTCCCCCG AAGGTCTCCACTCTGCTCTGGGCTTCCCTTTGCCTAGTGCAGGGAGCCATCTCTGGAGAAGAAGCAACAC TGTCCTTGGTGTGTCCCAAGCCTGGAGCGTATGTTCCCTGTTGGCCCACCCAGCCCCAGCACGGGAATTA TTTCCTGGGTTTCTGTCCATCTAAGGCTTAGGTGTAGTTGGCATTCGTTCTTCTGGGGGTGTTAGTCCTT CTACTTTCTATCTCACCTCACCCTGAACCCCCTTCTGTGTCTCTGCAGTCTTCTCTCCCTCCCACCACCC ATGTGCATGAGCAAATATGCAGCTAACCCTGGGACTTTGCAGTCAGTTGAAGCCAAGCTTCCCACATCTC CTCTTTGTTTGCCATGGGATGATGTGGGGCTTCCATCGTGTCTGTCATTACCTCTGTCTCTTTCCTAACC CAGTCTCACAGTTTATGTATAGTAGTAAGAGTTGTACTTCCACCAAAGGCATGTGACATATTTACCAATC TCATGTATTCTCAACAAAGGCGAAAAATACAAATTCCTACCACAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_009496
ORF Size 357 bp
Insert Size 357
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC049902, NP_033522
RefSeq Size 2578
RefSeq ORF 357
Locus ID 22317
Cytogenetics 6 F2|6 59.32 cM
Gene Summary Involved in the targeting and/or fusion of transport vesicles to their target membrane. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.