Plgrkt (NM_026362) Mouse Untagged Clone
CAT#: MC202175
Plgrkt (untagged) - Mouse RIKEN cDNA 5033414D02 gene (5033414D02Rik), (10ug)
"NM_026362" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Plgrkt |
Synonyms | 1110007H22Rik; 5033414D02Rik; AI852040; Plg-R(KT); Plg-RKT |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024953 sequence for NM_026362
CTCTGCTGCGGTCACCGTCCCCGCACCGTGTCGCGTGAGATCTCCAGAGGGACACTCCTGTTTGCCTTCT ATATTTAACCGTGTACCTGAGATTTCCCCCGACACATCCAAAGTCCAAGTCCAAGAGAGCAAGGCCCAGA AGGAGGTCAAGATGGGGTTTATATTCTCGAAATCTATGAACGAAAACATGAAAAACCAACAGGAGTTCAT GGTTACGCATGCTCGGCTTCAGCTGGAAAGGCATCTGACCATGCAGAATGAGATGAGAGAAAGGCAAATG GCTATGCAGATCGCCTGGTCTCGGGAATTCCTCAAATATTTTGGAACGTTTTTTGGCATTGCAACCATCT CTTTAGCAACTGGAGCACTAAAGCGAAAGAAGCCAGCCTTTCTCGTTCCTATAGTCCCGCTAAGCTTCAT CTTCACCTACCAGTATGACCTGGGCTACGGAACTCTCCTACAGAGAATGAAAAGTGAAGCTGAGGACATA TTGGAAACAGAAAAGACGAAGCTGGAGCTGCCAAAAGGACTGATCACCTTTGAAAGCCTTGAGAAAGCCA GAAGGGAGCAGAGTAAACTCTTCTCAGACAAATGAAGTCACAGTTATCCTCAGAGCACATATCGTGTCTC AAAAGCACAAAGTTGTTGGCTTGAATCATGGTGTTTACAGTTTTTTAAATGATCAAGATTTTGATATGAT GCATTTTTATTTTAGAATATTAAAATTCAAAATGAATTTGTTGAACTATTTTAAAATAAAATTTCTAACA CTCCAAAAAAAAAAAAAAAG |
Restriction Sites | RsrII-NotI |
ACCN | NM_026362 |
Insert Size | 444 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC024953, AAH24953 |
RefSeq Size | 790 bp |
RefSeq ORF | 444 bp |
Locus ID | 67759 |
UniProt ID | Q9D3P8 |
Cytogenetics | 19 C1 |
Gene Summary | Receptor for plasminogen. Regulates urokinase plasminogen activator-dependent and stimulates tissue-type plasminogen activator-dependent cell surface plasminogen activation. Proposed to be part of a local catecholaminergic cell plasminogen activation system that regulates neuroendocrine prohormone processing. Involved in regulation of inflammatory response; regulates monocyte chemotactic migration and matrix metalloproteinase activation, such as of MMP2 and MMP9.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201006 | Plgrkt (tGFP-tagged) - Mouse RIKEN cDNA 5033414D02 gene (5033414D02Rik) |
USD 350.00 |
|
MR201006 | Plgrkt (Myc-DDK-tagged) - Mouse RIKEN cDNA 5033414D02 gene (5033414D02Rik) |
USD 150.00 |
|
MR201006L3 | Lenti ORF clone of Plgrkt (Myc-DDK-tagged) - Mouse RIKEN cDNA 5033414D02 gene (5033414D02Rik) |
USD 450.00 |
|
MR201006L4 | Lenti ORF clone of Plgrkt (mGFP-tagged) - Mouse RIKEN cDNA 5033414D02 gene (5033414D02Rik) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review