Metrnl (NM_144797) Mouse Untagged Clone

CAT#: MC202114

Metrnl (untagged) - Mouse meteorin, glial cell differentiation regulator-like (Metrnl), (10ug)


  "NM_144797" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Metrnl"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Metrnl
Synonyms 9430048M07Rik; BC019776
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC024445 sequence for NM_144797
GGAACTTGCCAGCTCAGAGGTTCTAGGGGCAGCCGGCGCGCTTCTCTAGTTGCAGCTTGGGCGGCTCCTG TGGTGGGCGGCTAGGGGCGAGCCGGGATGGGCTATAGACGCGCGACGTGATCAGTTCGCACGCGGACCCA CGCCTCCCATCGCTCTGCCTCAAGAGCCTATTCTGTGGGTGCAGGCACGCACCGGACGCAGACCCGGCCG GAGCATGCGGGGTGCGGTGTGGGCGGCCCGGAGGCGCGCGGGGCAGCAGTGGCCTCGGTCCCCGGGCCCT GGGCCGGGTCCGCCCCCGCCGCCACCGCTGCTGTTGCTGCTACTACTGCTGCTGGGCGGCGCGAGCGCTC AGTACTCCAGCGACCTGTGCAGCTGGAAGGGGAGTGGGCTCACCCGAGAGGCACGCAGCAAGGAGGTGGA GCAGGTGTACCTGCGCTGCTCCGCAGGCTCTGTGGAGTGGATGTACCCAACTGGGGCGCTCATTGTTAAC CTACGGCCCAACACCTTCTCACCTGCCCAGAACTTGACTGTGTGCATCAAGCCTTTCAGGGACTCCTCTG GAGCCAATATTTATTTGGAAAAAACTGGAGAACTAAGACTGTTGGTGCGGGACATCAGAGGTGAGCCTGG CCAAGTGCAGTGCTTCAGCCTGGAGCAGGGAGGCTTATTTGTGGAGGCGACACCCCAACAGGACATCAGC AGAAGGACCACAGGCTTCCAGTATGAGCTGATGAGTGGGCAGAGGGGACTGGACCTGCACGTGCTGTCTG CCCCCTGTCGGCCTTGCAGTGACACTGAGGTCCTCCTTGCCATCTGTACCAGTGACTTTGTTGTCCGAGG CTTCATTGAGGACGTCACACATGTACCAGAACAGCAAGTGTCAGTCATCTACCTGCGGGTGAACAGGCTT CACAGGCAGAAGAGCAGGGTCTTCCAGCCAGCTCCTGAGGACAGTGGCCACTGGCTGGGCCATGTCACAA CACTGCTGCAGTGTGGAGTACGACCAGGGCATGGGGAATTCCTCTTCACTGGACATGTGCACTTTGGGGA GGCACAACTTGGATGTGCCCCACGCTTTAGTGACTTTCAAAGGATGTACAGGAAAGCAGAAGAAATGGGC ATAAACCCCTGTGAAATCAATATGGAGTGACTTGCAGGGTGACACAGTACTGTTGTCCTTCAGATGAGCC ATGTTTTGTGGGCTCAGTCGCTCTATCATATCCTGATAGAGATTGCAGACTGGTGGCATGGGCCCAGCCT GGTGCTAGAACTGGGAAGGTACATGCTGCTCTGACCCCTTAGGTCCCAGCCAAGGATGCCCTGACCCATT GGAACTGCTGTAAAATGCAAACTAAGTTATTATATTTTTTTTGTAAAAGAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_144797
Insert Size 936 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC024445, AAH24445
RefSeq Size 1396 bp
RefSeq ORF 936 bp
Locus ID 210029
UniProt ID Q8VE43
Cytogenetics 11 E2
Gene Summary Hormone induced following exercise or cold exposure that promotes energy expenditure. Induced either in the skeletal muscle after exercise or in adipose tissue following cold exposure and is present in the circulation. Able to stimulate energy expenditure associated with the browning of the white fat depots and improves glucose tolerance. Does not promote an increase in a thermogenic gene program via direct action on adipocytes, but acts by stimulating several immune cell subtypes to enter the adipose tissue and activate their prothermogenic actions. Stimulates an eosinophil-dependent increase in IL4 expression and promotes alternative activation of adipose tissue macrophages, which are required for the increased expression of the thermogenic and anti-inflammatory gene programs in fat. Required for some cold-induced thermogenic responses, suggesting a role in metabolic adaptations to cold temperatures.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.