Ndufs8 (NM_144870) Mouse Untagged Clone
CAT#: MC201958
Ndufs8 (untagged) - Mouse NADH dehydrogenase (ubiquinone) Fe-S protein 8 (Ndufs8), nuclear gene encoding mitochondrial protein, (10ug)
"NM_144870" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Ndufs8 |
Synonyms | BC021616; CI-23kD; TYKY |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC021616 sequence for NM_144870
CAGGGAAGGAGCCGCAGCACTTCAAGATGTATCGCCTGAGCTCATCAATGCTGCCACGGGCCTTGGCCCA GGCCATGCGCACAGGACATCTTAATGGACAAAGCCTTCATAGCAGCGCAGTGGCGGCAACGTACAAGTAT GTGAATAAGAAGGAACAGGAGTCTGAGGTGGACATGAAGTCCGCAACTGACAGTGCAGCTCGGATTCTGA TGTGGACAGAACTCATCCGAGGACTGGGCATGACCCTAAGTTACCTCTTTCGAGAGCCTGCCACCATCAA CTACCCCTTTGAGAAGGGCCCACTGAGTCCGCGCTTCCGTGGGGAGCATGCACTGCGCCGCTACCCATCT GGAGAGGAGCGTTGCATTGCCTGCAAACTCTGTGAGGCCATCTGTCCTGCACAGGCCATCACCATTGAGG CTGAGCCAAGAGCCGATGGCAGCCGCCGGACGACACGCTATGACATCGACATGACCAAGTGTATCTACTG TGGTTTCTGCCAGGAAGCCTGCCCTGTTGATGCCATTGTGGAGGGCCCCAACTTCGAGTTCTCCACCGAG ACACACGAGGAGTTGCTGTACAACAAGGAGAAGCTACTCAACAATGGAGACAAGTGGGAGGCCGAGATCG CTGCCAACATCCAGGCTGACTACCTGTACCGGTGACCAGACCACTGGTGACCTTGGCCACCTGGCTCAGC CTTGTGGCCCCTTTAGCCCATAAAGAAACTATGATCCCACAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_144870 |
Insert Size | 639 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC021616, AAH21616 |
RefSeq Size | 755 bp |
RefSeq ORF | 639 bp |
Locus ID | 225887 |
UniProt ID | Q8K3J1 |
Cytogenetics | 19 A |
Gene Summary | Core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) that is believed to belong to the minimal assembly required for catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202305 | Ndufs8 (tGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) Fe-S protein 8 (Ndufs8) |
USD 500.00 |
|
MR202305 | Ndufs8 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) Fe-S protein 8 (Ndufs8), nuclear gene encoding mitochondrial protein |
USD 300.00 |
|
MR202305L3 | Lenti ORF clone of Ndufs8 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) Fe-S protein 8 (Ndufs8), nuclear gene encoding mitochondrial protein |
USD 600.00 |
|
MR202305L4 | Lenti ORF clone of Ndufs8 (mGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) Fe-S protein 8 (Ndufs8), nuclear gene encoding mitochondrial protein |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review