Zfp748 (NM_001035231) Mouse Untagged Clone

CAT#: MC201887

Zfp748 (untagged) - Mouse zinc finger protein 748 (Zfp748), transcript variant 1, (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Zfp748 (NM_001035231) Mouse Untagged Clone
Symbol Zfp748
Synonyms KRAB-O; mszf54; Rslcan20/21; Zfp208
Vector pCMV6-Kan/Neo
Sequence Data
>BC055310 sequence for NM_001035231
AAGAGGTAATCCGCACTTCCGCATTGCGACTGCACTAGTGCATTTTCTCTCAAAGTTGGGCGATTCTCTG GTCCTGCTCCGCGCTCGGCTTGCATCGCTGACATGGAGGAAATGCTGTCATTCAGGGATGTGGCCGTTGA TTTCTCTGCAGAGGAGTGGGAGTGCCTGGAGCCTGCTCAGTGGAATCTGTACAGGGACGTGATGCTGGAG AATTACAGCCACCTTGTGTTCCTGGGTCTTGCTTTCTCTAAGCCATACCTGGTCACGTTTCTGGAGCAAA GACAAGAGCCTTTGAATGAGAAGAGACAAGTGGCCACCACCATGCACCCAGATATAAAACCATATAAATG TAAAGAATGTGGCAAAGCCTGTGATTGGAACTCACTCCTTCTCGAACACCAGAGAACCAATCCAGGAGAG AATGCCTACAAGTGTGAAGAATGTGGTCAGGCTTCTGGCTCTTACTCAGTAATTCCTGAACACCATATAA ACGATACGGAAGAGAAAGCCTGCAAGTGTGAAGAATGTGGTAAAGTCATTTGTACTTGCTCAGAAAATTC TAGCTACCAGAGAATTTGCATTGGAGAAAACCCCTACAAGTGTGAAGAATGTGGAAAAGCCTTTTCTTCT CATTCATGTCTTGCTCAACATGAGGTAGAACACACTGGACAGCAATTTTATAACTGTGAAGAATGTGGGA AACTGTTTTATTGTCCTTCTCACCTTACAGAACATCAAAAAATTCATTCTCAAGAGAATCTCTTTAAGAT TGAGGTATGTAGCGAGGTCTTTTGTGCTCCCATAGAACTTTCTAAAGACCAGAACTTTTGTACTGAAGAA AAACCCTACAGGTATGAAGACTATGTTAAGGCCTTTAGCGCTTGCTCAGTTCTTTCTGAACACCCGACAA TTCATCCAGGAGAGAAAGCATTCAAGTGTGAAGAATGTGGCAATGCCTTTTGTACACTCCATTCAGTCTC TAAAATGAAAATTCATTATGAAGTGAAATCCTACAAGTGTGAAGAGTGTGGGAAAGCCTTTGCTACTCAT CTTTCCCTGATTCAGCATAAGATAGGTCATACTCGAGAGAAACCTTATCAATGTGAAGAATGTGGCAAAA TGTTTTACTGTTCTTCAAACCTTAAGCAACATCAAATAACTCATTCTCAAGAGAAACCCTACAAGTGTGA AGTATGTGGCAAGGTCTTTAGAACTTGCTGGCAACTTTCTAAACACCTGAGAATCCATTCTGGAGAGAAA CCATACAAGTGTGAGGAATGTGGCAAAGCCTTTTATACTCTCTCCTACCTTACTCAGCACAAATTAGGTC ACACTGGGGAGAAACCTTACAAATGTGAGGAATGTGGCAAAACCTTTTACTACCCTTCAGTCCTTAAGGA ACACCTAGCAATTCATTCTGGAGAGAAACCGTACAGGTGTGATGAATGTGGCAAGGACTTTTGTACTCGC TCAGGACGTTCCAGACACCAGAGAATCCATACTGGAGAGAAACCGTACAAGTGTGAGCAATGTGGAAAGG CCTTCAGTACCCATTCATACCTTTCTCATCACAAGATAGTTCACACTGGACATAAACCCTACAAGTGTGA AGAGTGTGGCAAAAAATTTTATTATCCTTCTCGACTTAAGGAGCATCAAAGGATTCATTCTCAAGAGAAT CCCTACAAGTGTGAAATATGTGGCAAAGCCTTTTATACTCACTCATACTTTACCCAGCACAAATTAGGTC ACACTGGGGAGAAACCTTACAAATGTGAGGAATGTGGCAAAACCTTTTACTACCCTTCAATCCTTAAGGA ACACCTAGCAATTCATTCTGGAAAGAAACCGTACAGGTGTGAAGAATGTGGCAAGGACTTTTGTACTCGC TCAGGACGTTCCAGACACCAAAGAATCCATACTGGAGAGAAACCCCACAAGTGTGAAGAATGCGGAAAAG TCTTTTCTACTCATTCATATCTTACTCAGCACAAAGTAGTCCACTCTGGAGAGAAGCCCTACAAGTGTGA GGAGTGTGGCAAAAAGTTTTACTATCCTTCTCGCCTTAAGGAGCATCAAAGGATTCATTCTCAAGAGAAT CCTTACAAGTGTGAAATATGTGGCAATGTATTTTGTACTCCCAAAGGACTTTCGAAACACCAGAGATTTC ATACTGGAGAGAAACCCTACAAGTGTGAAGAATGCGGGAAAATGTTTTATTATCCTTCTCGACTTAAGGA ACATCAAAGAATTCATTCTCAAGAGAATCCTTACAAGTGTGAAATATGTGGCAAAGCCTTTTATACTCAC TCCTACCTTACTCAGCACAAATTAGGTCATACTGGGGAGAAACCTTACAAATGTGAGGAATGTGGCAAAA CCTTTTACTACCCTTCAATCCTTAAGGAACACCTAGCAATTCATTCTGGAAAGAAACCGTACAGGTGTGA AGAATGTGGCAAGGACTTTTGTACTCGCTCAGGACGTTCCAGACACCAGAGAATCCATACTGGAGAGAAA CCCTACAAGTGTGAGCAATGTGGAAAGGCCTTCAGTACTCACTCATACCTTTCTCAACACAAGGTAGTCC ACTCTGGAGAGAAGCCCTACAAGTGTGAAGAGTGTGGCAAAATGTTTTACTATTCTTCTCGACTTAAGGA GCATCAAAGGATTCATTCTCAAGAGAATCCCTACAAGTGTGAAGTGTGTGGCAAAGTCTTTAGTGCTCAC TTAGAACTTGCTACCCACCTAAGTATTCATTCCGGATAAAACCGTACAAGTGGGAAGGATATGGAAATGC TTTTTAACTCATCCATCCTTACCTCAGAACAGATTCCTGAACAGAATTCTTAACAATGTGAAGAATGGCA AAATGTTTTCTATCCTCCAAACCTTAAGCCTTTGGAGGGAAACCATTCTCACGTGTGGACTGTAGCAAGG TCTTTTGTACTCACTTAGGACTTTCTAAACATCAAAAGAACCATACTGGTAAGAAAGACCACAAATGTAG GAAAGCTACTAAACTTTTTAACCTTACTCACCACGAGGTAGTTCTTTCTGTTCAGAAACACTATAGAAGA GGAAATGCTGGAAAATTCTTTACTCTTTTTCAATCCTTAAAGAATATCACAGAGGTCATTCTCAGGAGAG ACCCTACAAGTATGAGGATTGTACTTTTGGTTATTCAGATCTTATCCAACACAATTGGATCCATACTAAA AAGAAACCAAACCTTTGTGAAGAATGTGACAAGTGCTTTACTAATCAACACTTTCTAACCTTAAAATTTA TTCTGGGGAGAAACACTACAAATGTGAACAAATTGACAAGGCTTTTAAATGTTCTTCATAGATTAACACA AAAGTATTGGTACTGGTAAAATGTATTATGAAGATTTCATTCATCATTCAGTATTTGCTGAATGTCAGAA TATTCACACTTGGGAGAATCTCTATAAATGTGCAAAATATAGCCAGGTGTTTAGCTGTAATTTGTCACTG CATTAGCATGAGAGAATTAATACTCCAAAAATACAAAGAATATAGCAAGGCCTTTACCCGTTTTTTCATA CTTTATCCTCAGAAACTTCATACTGTAGAGAAACTGCACATACAAATAACATGTCAAACTTTTAATAATA TTTCAAATCTCAGTCAACACCAAAGAATGAATTCAGTAAGCTACACTGTTTGACTTTACATCTCGGCATC TAAGGAAAGCTCAACCGTATGCTTGTTTGAATCGGACTAACTTACAGATGTGTCTATAGGACATTTTTCT TGGATGTTGATTGATGCCCAGTCTCACCCCTGGACTGGTGGTCCTGAGTGAATGAGAATTCTGGCCACCA AAAATCAGAGGGAGCAAGCCAGTAAGCAGAATTCCTCAATGGTTTCTACTTTAGTTCCTGTCTCAAGGTT TTTCCCTTGAGTTCTCATCCTGGCTGAACTGGTTGACTAACTGTAATTCCTAAACTGAAATAAACCCTTT CCTCTTTTAAGTTATTTCTTAGTCATGGCATTTATCACAGCAACAGAAATCAAACTCAGGCAGCAAAGAA TATGGGAAAGCTTTTTACTTTTCTTTATATCTTAGTTATTATCAGAGTCTTCATACTGAGAATGTCACAG TGTTGGTTTGGTTTTTTGTTTTTGAAATGGAAAATTAGACTGCTAGTGTCAGCTAAGAACATATGAGTCC TTTAGCAGAGACTTCTGTTTGCCATAATCTACCAATCTATTCTTTCAGACAATGTGTTTTTCAAGAGTCA TTGATTGTTCTTTGAACTATAAATTTTTCCTGAAACTGTAGCCATGTTGTCAGACTGTACCTGAGTACTC TCAATCTGGATTTCTGAGCCATGACTTATATGGCAGATTTTGCCCTTTGGGTCCCCCAATTGTAAGTAAC TCTTACCCTTTGGTCTGTAAGAAAACCCAATACATTCACTTTTCTCATCAACTTGGGCTGTAGTGAAATC CTAAGATGGTGTGTTGTGGGGTCCCTTTGTAGTGACTAGACATTTATTTGTGTCTATAGATAGCTAACAA CACATGTCATTCATATTTGGCTCCAAAATAAACAAAGTAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_001035231
ORF Size 2667 bp
Insert Size 2667
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC055310, NP_001030308
RefSeq Size 4608
RefSeq ORF 2667
Locus ID 212276
Cytogenetics 13|13 B3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.