Sh3glb1 (NM_019464) Mouse Untagged Clone

CAT#: MC201801

Sh3glb1 (untagged) - Mouse SH3-domain GRB2-like B1 (endophilin) (Sh3glb1), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Sh3glb1 (NM_019464) Mouse Untagged Clone
Symbol Sh3glb1
Synonyms AA409932; AI314629; AU015566; Bif-1; mKIAA0491
Vector pCMV6-Kan/Neo
Sequence Data
>BC024362 sequence for NM_019464
GCCGTCGCCGTCGCCCGGCGCCCCAGCCCGGCCGCGGCGCTCCCCGCCTCCCCGCTAGCGCAGCCGGCGG CTCTGCCCGGCTGCCGCCCGGCATGAACATCATGGATTTCAACGTGAAGAAGCTGGCGGCCGACGCGGGC ACCTTCCTCAGCCGGGCCGTGCAGTTCACAGAAGAAAAGCTTGGCCAGGCAGAGAAGACAGAACTGGACG CTCACCTGGAAAACCTCCTTAGCAAAGCTGAATGTACCAAAATATGGACAGAAAAGATAATGAAGCAGAC CGAAGTGCTGTTGCAGCCAAATCCAAATGCCAGGATAGAAGAATTTGTTTATGAGAAACTGGATAGAAAA GCACCAAGTCGTATAAACAACCCGGAACTTTTGGGACAATATATGATTGATGCAGGAACTGAGTTTGGCC CAGGGACAGCTTATGGAAATGCCCTTATTAAATGTGGAGAAACACAGAAGCGAATTGGAACAGCTGACCG AGAGCTGATTCAAACATCAGCCTTAAATTTCCTCACTCCTTTAAGAAACTTTATAGAAGGGGATTACAAA ACAATCGCAAAAGAAAGGAAACTATTACAGAATAAGAGACTGGATTTGGATGCTGCAAAAACAAGACTAA AAAAGGCAAAAGCTGCAGAAACTAAAAGTTCATCTGAACAGGAATTGAGAATAACTCAAAGTGAATTTGA TCGTCAGGCAGAGATTACCCGACTCCTGCTTGAGGGAATCAGCAGTACACACGCCCATCATCTCCGCTGT CTGAATGACTTTGTAGAAGCCCAGATGACTTACTATGCACAGTGTTACCAGTATATGCTAGACCTACAGA AGCAACTGGGAAGTTTTCCATCCAATTATCTTTCTAACAACAATCAGACCTCTGGGACACCAGTGCCATA TGCTTTGTCAAATGCAATTGGTCCTTCTGCCCAGGCTTCAACGGGTAGCCTTGTAATCACCTGTCCTTCT AACCTCAATGACCTTAAAGAATCCAGCAACAACAGGAAGGCTAGGGTCCTCTATGATTATGATGCTGCAA ATAGCACTGAACTGTCACTCCTGGCCGATGAGGTAATCACTGTGTTCAGTGTCGTTGGAATGGACTCCGA CTGGCTAATGGGAGAGAGAGGAAATCAAAAGGGCAAGGTGCCAATTACCTACTTAGAACTTCTCAATTAA ACAGGGAGACCACGAGAGGTTACCCATCACAACACCATATTTATATAAATAACTCTAAAGCAGGTTTAAA TATCTTCCAATGTTAATGTCATAAGAGACTGAAAAAGAAAAATTATAAGCCATCAGAAACTGGCCATTCT GCCAATAAAACTGCATGGTTAATCCTTCATTACAGAATCTATGTTAGCGATTTCATGACAGGAGTGTTTT CTTAAACAATTCTCTTTCTACTGAGGTTTTACTAACAAGCAACTTCTACTTTTGAGCCCCAACTTAAAAA TGAAAGGATTCTTTTCTACTGAATTTTTCATTAACAGGAAGCTTTTTCTTTTATGCAAAATAAATTTATT GTGCATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_019464
ORF Size 1098 bp
Insert Size 1098
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC024362, NP_062337
RefSeq Size 1579
RefSeq ORF 1098
Locus ID 54673
Cytogenetics 3|3 H2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.