Hopx (NM_175606) Mouse Untagged Clone

CAT#: MC201799

Hopx (untagged) - Mouse HOP homeobox (Hopx), transcript variant 1, (10ug)


  "NM_175606" in other vectors (5)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Hopx"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hopx
Synonyms 1110018K11Rik; 1200015P04Rik; 2300002F06Rik; AI848177; AW490897; Cameo; Hdop; Hod; Hop
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC024546 sequence for NM_175606
CCGGATCTCCGGAGGCAGCACTTGAGGCGCTTCCTCAGTATACTGTCCCCTCGGAGTGTCAGGCGGGAGG CGTCTTCTTCCTCCTCTCCATCCTTAGTCAGACGCGCACGGACCATGTCGGCGCAGACCGCGAGCGGCCC CACGGAGGACCAGGTGGAGATCCTGGAGTACAACTTCAACAAGGTCAACAAGCACCCGGACCCCACCACG CTGTGCCTCATCGCAGCCGAGGCGGGTCTCACGGAGGAGCAGACGCAGAAATGGTTTAAGCAGCGCCTGG CAGAGTGGCGGCGGTCAGAAGGCTTGCCTTCGGAATGCAGATCTGTTACGGACTAGGGAGCCAGGCCCTT GAGCTTGCTCTTGGAACTCCATCTCTTCTTCCTTCCCTCGGCTTACCCAGGCTGTTTTGATGTTTCAGTG CAGTGTTGAATGTCTCATTGTTTTGCTGTCCTGCTATTTAACACAATGTGTTTTTTTTTTTATGTATATA ACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_175606
Insert Size 222 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC024546, AAH24546
RefSeq Size 544 bp
RefSeq ORF 222 bp
Locus ID 74318
UniProt ID Q8R1H0
Cytogenetics 5 C3.3
Gene Summary Atypical homeodomain protein which does not bind DNA and is required to modulate cardiac growth and development. Acts via its interaction with SRF, thereby modulating the expression of SRF-dependent cardiac-specific genes and cardiac development. Prevents SRF-dependent transcription either by inhibiting SRF binding to DNA or by recruiting histone deacetylase (HDAC) proteins that prevent transcription by SRF. Overexpression causes cardiac hypertrophy (PubMed:12297045, PubMed:12297046). Acts as a co-chaperone for HSPA1A and HSPA1B chaperone proteins and assists in chaperone-mediated protein refolding (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.