Pam16 (NM_025571) Mouse Untagged Clone

CAT#: MC201789

Pam16 (untagged) - Mouse presequence translocase-asssociated motor 16 homolog (S. cerevisiae) (Pam16), nuclear gene encoding mitochondrial protein, (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Pam16 (NM_025571) Mouse Untagged Clone
Symbol Pam16
Synonyms 2010110I09Rik; AV006767; CGI-136; Magmas; Tim16; Timm16
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC024346 sequence for NM_025571
CCACCAGCAACCCTTGAGCTGGTCCCACTGGGTCGGGAAGCGGCACCCGTCCCCCTAAAGTGGAGCGTCC GCCATGGCCAAGTACCTGGCCCAGATCATTGTGATGGGTGTGCAGGTGGTGGGCAGAGCCTTTGCCAGGG CCCTGAGGCAGGAGTTTGCAGCCAGCCAGGCAGCCGCTGACGCTCGAGGGCGTGCTGGGCACCAGTCTGC AGCTGCATCCAATCTCTCTGGCCTCAGCCTCCAGGAAGCCCAGCAGATTCTCAACGTCTCCAAGCTGAGC CCCGAGGAGGTCCAGAAGAATTATGAACACCTATTTAAAGTGAATGATAAGTCCGTGGGTGGCTCTTTCT ACCTGCAGTCAAAGGTTGTCCGTGCAAAGGAACGTCTAGATGAGGAACTCCGAATACAAGCCCAGGAAGA CAGAGAGAAAGGGCAGAAGCCCAAAACGTGACTGCTGGGCTCTCCACACCCCAGCCATTGCCTCATAATT TATAGCCTAGTAATAAATGTCTTTTGCGTGTTTAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_025571
ORF Size 378 bp
Insert Size 378
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC024346, NP_079847
RefSeq Size 539
RefSeq ORF 378
Locus ID 66449
Cytogenetics 16 A1|16 2.45 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.