Gprc5a (NM_181444) Mouse Untagged Clone

CAT#: MC201777

Gprc5a (untagged) - Mouse G protein-coupled receptor, family C, group 5, member A (Gprc5a), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gprc5a (NM_181444) Mouse Untagged Clone
Symbol Gprc5a
Synonyms Rai3; Raig1
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC036173 sequence for NM_181444
CCCACGCGTCCGCCCACGCGTCCGCGACCCACGCGTCCGACCCACGCGTCCGCTGCCCAGTAGCCAGGGG TTGAGCGCTCTCGCCTTTCACGCGTGAGTCGCAAGTTCTCGGTTCACCCCGAGCGCCGCAGCGCCCAGGA CCAACCAGAATGACTACTCCTACAACTGCCCCTAGCGGTTGCCGCTCAGACCTGGATTCCAGGTACCACA GACTTTGTGACCTGGCGGAAGGCTGGGGCATCGCGTTGGAAACACTGGCTGCAGTCGGGGCTGTGGCTAC CGTGGCTTGCATGTTTGCACTCGTTTTCCTCATCTGCAAAGTGCAGGACTCCAACAAAAGAAAGATGCTC CCCGCCCAGTTCCTCTTCCTCCTGGGAGTGCTAGGGGTCTTTGGCCTCACCTTCGCCTTCATCATCAAGC TGGATGGGGCCACAGGACCCACGCGCTTCTTCCTCTTCGGAGTCCTCTTCGCCATCTGCTTCTCTTGCCT CCTGGCCCACGCTTTCAACTTGATCAAGCTGGTCCGAGGGAGGAAGCCCCTGTCGTGGCTTGTGATCCTC AGCCTGGCGGTGGGCTTCAGCCTGGTCCAGGACGTCATTGCCATTGAATACCTGGTCCTCACCATGAACA GGACCAACGTCAATGTCTTTTCTGAGCTGCCTGCTCCTCGGCGCAATGAGGATTTCGTCATGCTCCTCAT TTACGTGCTCGTCTTGATGGTGCTGACCTTCTTCACATCCTTCTTGGTTTTCTGTGGATCCTTCTCTGGC TGGAAGAGACACGGGTTCCACATATGCTTCACCTCGTTCCTCTCCATTGCCATCTGGGTGGCCTGGATCG TTCTGCTCCTGATTCCCGACATTGACCGGAAATGGGATGATACCATTCTCAGCACAGCCTTGGTGGCCAA TGGCTGGGTTTTCCTGGCATTTTATATCTTGCCCGAGTTTCGACAGCTCCCAAGGCAACGGAGCCCCACT GATTACCCAGTTGAAGATGCTTTTTGTAAACCTCAGCTCATGAAGCAGAGCTATGGTGTGGAGAACAGAG CCTACTCCCAAGAGGAAATCACCCAAGGTCTTGAGATGGGGGACACACTCTATGCACCTTATTCCACCCA TTTTCAGCTACAGAATCACCAAAAGGATTTCTCTATCCCGAGGGCCCAGGCCCCGGCCAGTCCGTACAAT GACTACGAAGGGCGCAAAGGCGACAGCTAAGTGTTGGGAAGAGTGGGACAACCAGAGGCAGGTAGCAGGT CCAGCCAGGAATCCTGCTGATGTGAACTGAACTCAGGGCATCCCGGGGAAACAGTACAGAGAGGCTTGCA ACCTGCCCAGCACACCGCCGTCTTGCCTGGGGCTGCTAAGCCTAACAAACTGTCTTCAAAGAGCTCCAGG GTTTCATTTGCCCCATTCCTAGGACACTTCTGGGAGGTGGGAGTCTTGGCAACTCCGGGTGAGACTCTTA CCTCTCCCGGGAGTATGAGCAAGCCTCCAGTCATCTGACTGCTCACTGTTTGGTCATCCTTGGAAGCCAG TTCACCTAACCCACGGTGGGTTCTATGAGGAGTTGCTCCATACCAAGCAGAACTGAAGATTTGGATAAAC CCAGAGAAGTCTGGGTCTCCGCCTTGTCCATCTCATCCACACTGGAAGCTAATCTGGTCGCGCCCTCCAA GGCTTTCCTGCCGGGGGAGGAACGGCTAAAGGTCACGTGTCTACCCTCAGTGCACTGCCCCACAGTGGCC TCTCGGTGCAGACACCGATTTCCAAGGGCCATGTTTTTATCCCAATTGCCTCCAAACTCACTGCCAACCC CAGACCTCTGTGTCCTTTGCCAGGAGCTCTTTGGGACATTACTGGAGTAGACAAGGTCTGTTTCTCTCTG CCAGGAGAATTTGGGTTTTGTTCTCGCTATAAATTCCTGGCCCTTGCCCCCCCCCCCCCCACAACCCCCA TCCTCAGTAATACGCTCACCCTGACCTCCTGACCTCCCTACGTGTCTATTCTTGGGGTGGGATGCATTTG TTATGTGGTAAATTATTCACCTGGGTATGCAATAAAGATGTGGTCACAACTATTTTTAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_181444
ORF Size 1071 bp
Insert Size 1071
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC036173, NP_852109
RefSeq Size 2174
RefSeq ORF 1071
Locus ID 232431
Cytogenetics 6|6 G1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.