Map3k20 (NM_023057) Mouse Untagged Clone

CAT#: MC201671

B230120H23Rik (untagged) - Mouse RIKEN cDNA B230120H23 gene (B230120H23Rik), transcript variant 1, (10ug)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Map3k20 (NM_023057) Mouse Untagged Clone
Symbol Map3k20
Synonyms AV006891; B230120H23Rik; MLTK; MLTKalpha; MLTKbeta; Zak
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC023718 sequence for NM_023057
CCACGCGTCCGTTCAACTCCTGACTCCGGCGGAAGCGTGGGAGCCGCGCGGGCCGCCGTCCCCGACCCCC GCCGCCGCTCGCGCCCGATCCGGGAGCCAGATTTTGTGGACGTTTACTACTTTGTCATTATGAGATGTCG TCTCTCGGAGCCTCCTTTGTGCAAATTAAGTTCGACGACTTGCAGTTTTTTGAAAACTGCGGTGGAGGAA GTTTTGGGAGTGTGTATCGAGCCAAATGGATATCACAGGACAAGGAGGTGGCTGTAAAGAAGTTACTCAA AATAGAGAAAGAGGCAGAAATCCTGAGCGTCCTCAGTCACAGAAACATCATCCAGTTTTATGGAGTGATT CTGGAACCTCCCAACTATGGCATCGTCACAGAATATGCTTCCCTGGGCTCCCTGTATGATTACATTAACA GCAACAGGAGTGAAGAGATGGACATGGAACACATCATGACCTGGGCCACTGACGTAGCCAAAGGGATGCA TTACTTACACATGGAAGCTCCTGTCAAGGTGATCCACAGAGACCTCAAGTCAAGAAACGTTGTTATCGCT GCTGACGGAGTGCTGAAGATCTGTGACTTCGGTGCCTCGCGGTTCCATAACCACACAACACACATGTCCT TGGTTGGAACTTTCCCATGGATGGCTCCAGAAGTTATCCAGAGTCTCCCTGTGTCTGAAACCTGTGACAC GTATTCCTATGGTGTGGTTCTCTGGGAGATGCTAACAAGGGAGGTCCCCTTTAAAGGTTTGGAAGGATTA CAAGTAGCTTGGCTTGTAGTGGAAAAAAACGAGAGATTAACCATTCCAAGCAGCTGCCCCAGAAGCTTTG CTGAACTGCTACACCAGTGTTGGGAGGCTGATGCCAAGAAACGGCCATCGTTCAAGCAAATCATTTCAAT CCTGGAGTCTATGTCAAATGACACGAACCTTCCTGACCAGTGTAACTCATTTTTACACAACAAGGCGGAG TGGAGGTGTGAAATTGAGGCAACCCTTGAGCGACTGAAGAAACTAGAGCGAGATCTCAGCTTTAAAGAGC AGGAGCTCAAAGAACGGGAGAGACGTCTCAAGATGTGGGAGCAGAAGCTGACGGAGCAATCCAACACCCC GCTGCTGCCTTCCTTTGAGATTGGTGCGTGGACTGAAGACGATGTGTATTTTTGGGTTCAGCAGCTCGTC AGAAAAGGCGAGTCTTCAGTAGAGATGAGTGGATACGCAAGTTTGTTTAAGGAGAACAACATCACAGGCA AGCGGTTGCTGCTTCTGGAAGAGGAAGATCTGAAAGACATGGGCATCGTCTCCAAGGGACACATCATTCA CTTTAAGTCAGCTATTGAGAAGCTAACCCACGATTATCTGAACCTGTTTCACTTCCCACCACTGATTAAG GATTCAGGAGGGGAACCTGAAGAAAATGAGGAAAAAATAGTGAACCTTGAACTTGTTTTTGGTTTTCACT TGAAGCCAGGAACTGGCCCACAGGATTGCAAATGGAAAATGTATATGGAGATGGATGGGGACGAAGTTGC AATCACGTACATAAAAGATGTGACTTTCAACACGAGCCTCCCTGATGCAGAGATTTTAAAGATGACAAAG CCACCATTTGTAATGGAGAAGTGGATCGTGGGAATAGCGGAGGATCAGACTGTGGAGTGCACGGTCACCT ATGAGAATGATGTCAGAACACCAAAACTCACTAAGCACGTGCACTCCATACAGTGGGACAGAACGAAGCC TCAGGATGAGGTGAAGGCGGTCCAGCTTGCCATTCAGACTCTGTTCTCCAGCTCAGAGGGCAACCCTGGC AGCAGATCCGACTCCAGTGCGGACTGCCAATGGTTAGACACTCTGCGCATGCGGCAGATTGCATCCCACA CTTCTCTACAGCGTTCCCAAAGCAACCCTATCTTGGGGTCTCCTTTCTTCCCTTACTTTGCCAACCAGGA TTCCTATGCTGCTGCGGTGAGGAGGACCCAGACTCCGGTGAAGTACCAGCAGATTACACCAAGCATCAAC CCTTCCCGGAGCTCCTCCCCCACGCAGTATGGGCTGTCCAGAAACTTCTCCTCCCTGAACCTCAGCTCCA GGGACAGCGGCTTCTCCAGCCTCAATGACAGCTCCTCCGAGAGGGGCCGCTACTCAGACCGAAGCAGAAA CAAGTACTACCGTGGTAGTGTGTCCCTCAATTCTTCCCCGAAAGGAAGATATGGTGGGAAAAGTCAGCAT TCCACACCTTCAAGAGAAAGATATTCTGGAAAGTTCTACAGGCTGCCCCAGTCAGCGCTGAACACTCATC AGTCCCCTGACTTCAAGAGGAGCCCAAATGACCATGACCGCCGTGTGCCCAGGACCATACCCGGGATGCC TCTGCACCCTGAGACTGCCTCCAAAGCAGGGGAAGAGGAGAGCAGGGTGAGCGAAGGGGGCTGGACTAAA GTGGAATATCGGAAGAAGACACACAGGCAACTTTCGGCCAAGACTAGCAAGGAGAGAACCCGTGGCAACT ACCGTGGGCGGCGGAATTTTTGAGGGATTGGGTCAGATGCGCTTTTCCAAGCGGGTTAGTAGTGCTTTGT GCAATGGATTTTTGGTAATAAGGTATCTTGAGGTTATAGGGACCAAAAAAAGACTAGTTCTGGGCTTGGG AAACACCTTTTAACTGAAAGGACAACCAAAGCAGGGCCTCAATTATGGCTGTTAGTCAGTCAACTAGAGG TGGCAATTAAACTTGACAATAACTGCCAATGTTTTGTCCCCTGAATTACTATTGAGGTGGGGAGGGCTAT GACATTGCCTGCTGGGAACATTCGAGCAGGCTTGGGGCCAGGATAAAGCTAGTGAGAACCACAGAAAAAT CATATTTCTGGACAAAACAGGATTCATCTTATCTTCTCTTTCATCTAAGTTCCAAGATGGCTCTGCAAAG CACTGTGGACGATTCTTGAGTTAAAATTTGTTTTTTGATTTTGGGGTTTTGTTTTTTTTTTTTTAACCTA CTGGGATAAAATATCATTTATCTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_023057
ORF Size 2409 bp
Insert Size 2409
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC023718, NP_075544
RefSeq Size 3079
RefSeq ORF 2409
Locus ID 65964
Cytogenetics 2|2 C3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.