Prelid1 (NM_025596) Mouse Untagged Clone
CAT#: MC201658
Prelid1 (untagged) - Mouse PRELI domain containing 1 (Prelid1), (10ug)
"NM_025596" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Prelid1 |
Synonyms | 2610524G07Rik; Preli |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC025859 sequence for NM_025596
GCGGTAGGGACCTGGGCGCGGTCCTGCGGAGATTGAGCTGCGAGCCTGGCGGGCGTGCGCCTAGCCACGT CCCCCCCACCCCCGGGCTCTTCACCCTGATGCTGCACGGGTGCTGAGCCCGTCCGGGTCGGGACGATGGT GAAGTATTTCCTGGGCCAGAGCGTGCTCCGAAGTTCCTGGGACCAAGTGTTCGCCGCCTTCTGGCAACGG TACCCGAATCCCTATAGCAAACATGTCTTAACCGAAGACATAGTGCACCGGGAGGTGACCCCCGACCAGA AGCTACTGTCCCGGAGACTCCTGACCAAGACCAACAGGATGCCACGTTGGGCAGAGCGACTGTTTCCTGC CAACGTTGCTCACTCCGTGTACATCCTGGAGGACTCTATTGTGGACCCCCAGAATCAGACCATGACCACC TTCACCTGGAACATCAACCATGCCCGGCTGATGGTGGTGGAGGAACGATGTGTTTACTGTGTGAACTCTG ACAATAGCGGCTGGACCGAAATCCGTCGGGAAGCCTGGGTCTCCTCTAGCTTATTTGGCGTCTCCAGAGC TGTCCAGGAATTTGGTCTTGCCCGGTTCAAAAGCAATGTGACCAAGACAATGAAGGGCTTTGAATACATC CTGGCCAAGCTACAAGGTGAGGCCCCTTCCAAAACCCTTGTTGAGACAGCCAAAGAGGCCAAAGAGAAAG CAAAGGAGACCGCACTGGCAGCTACAGAGAAGGCCAAGGACCTGGCCAACAAGGCCGCCACCAAGCAGCA GCAGCGGCAGCTCGTATAACTCGCTTCCTCTCCCTCTCCCCAGTGTACGTGATTATTAAAGAGCAACCTG CAGCCCTCTCTGCTGTCTGGGGTGGTGGGTCAGGGCCCTGTCCTGGTCAGCATCTGCACCACACCCAGCT CTGTCTGCCGGGCAGAGGGGTGCAGTGACTTGCCCAAGGTCACAGCAGTGCGCAGGTGATAGACTGTACG CTCCAAGAGGGCAGGGCTCCTTGTTTTATTCTCTGCTGTGTCCCAAGTACCCTGAACAATATTTAGCACA TAACAGGCACTCAATAAACACATGATTTGATTAGCCCCAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025596 |
Insert Size | 654 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC025859, AAH25859 |
RefSeq Size | 1103 bp |
RefSeq ORF | 654 bp |
Locus ID | 66494 |
UniProt ID | Q8R107 |
Cytogenetics | 13 B1 |
Gene Summary | Involved in the modulation of the mitochondrial apoptotic pathway by ensuring the accumulation of cardiolipin (CL) in mitochondrial membranes. In vitro, the TRIAP1:PRELID1 complex mediates the transfer of phosphatidic acid (PA) between liposomes and probably functions as a PA transporter across the mitochondrion intermembrane space to provide PA for CL synthesis in the inner membrane. Regulates the mitochondrial apoptotic pathway in primary Th cells. Regulates Th cell differentiation by down-regulating STAT6 thereby reducing IL-4-induced Th2 cell number. May be important for the development of vital and immunocompetent organs (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202413 | Prelid1 (tGFP-tagged) - Mouse PRELI domain containing 1 (Prelid1) |
USD 500.00 |
|
MR202413 | Prelid1 (Myc-DDK-tagged) - Mouse PRELI domain containing 1 (Prelid1) |
USD 300.00 |
|
MR202413L3 | Lenti ORF clone of Prelid1 (Myc-DDK-tagged) - Mouse PRELI domain containing 1 (Prelid1) |
USD 600.00 |
|
MR202413L4 | Lenti ORF clone of Prelid1 (mGFP-tagged) - Mouse PRELI domain containing 1 (Prelid1) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review