Nudt14 (NM_025399) Mouse Untagged Clone
CAT#: MC201565
Nudt14 (untagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 14 (Nudt14), (10ug)
"NM_025399" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Nudt14 |
Synonyms | 1110030M18Rik; UGPPase |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC025444 sequence for NM_025399
CCACGCGTCCGCCCACGCGTCCGCGCGGAAGAATCTGCTCTGCGCCACCATGGAGCGCATCGACGGGGTG GCCGTGGGCCTCTGTGCCCATTCGCCCTACCTGCGGCCTTTCACGCTGCACTACCGCCAGGACGGTGTCC AGAAGTCCTGGGACTTTATGAAGACACATGACAGTGTGACTATTCTCATGTTCAACTCTTCTCGGAGAAG CCTGGTGTTGGTGAAACAGTTCCGGCCAGCTGTATATGCAGGCGAGGTAGAGCGTCACTTCCCAGGGTCC CTGACAGCTGTGAACCAGGACCAGCCCCAAGAACTTCAGCAAGCACTGCCTGGCTCAGCGGGAGTGATGG TGGAACTCTGTGCCGGTATTGTGGACCAGCCTGGGCTCTCACTGGAAGAGGCAGCCTGCAAGGAGGCTTG GGAAGAGTGCGGCTATCGCCTGGTCCCCACCGATCTGCGCAGAGTTGCCACATACATGTCTGGAGTAGGA CTGACTAGCTCCAGGCAGACCATGTTCTACGCGGAGGTGACAGATGCCCAGCGAGGCGGGCCTGGTGGAG GGCTGGCCGAGGAGGGAGAACTCATCGAAGTGATCCATCTGAATTTAGATGACGCCCAGGCCTTCGCAGA CAACCCTGACATCCCCAAGACTCTCGGGGTTATCTACGCTATCTCTTGGTTCTTTAGCCAGGTGGTTCCC CATTTGAGTCTCCAGTGAGACCTTGGGGCTGGACAGGCCTAATCCCATCCACTCATCCTCCTGCCCTGCG CACCCAATAAAGCTTGTGTAAGTTTAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025399 |
Insert Size | 669 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC025444, AAH25444 |
RefSeq Size | 821 bp |
RefSeq ORF | 669 bp |
Locus ID | 66174 |
UniProt ID | Q9D142 |
Cytogenetics | 12 F1 |
Gene Summary | Hydrolyzes UDP-glucose to glucose 1-phosphate and UMP and ADP-ribose to ribose 5-phosphate and AMP. The physiological substrate is probably UDP-glucose. Poor activity on other substrates such as ADP-glucose, CDP-glucose, GDP-glucose and GDP-mannose (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202556 | Nudt14 (tGFP-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 14 (Nudt14) |
USD 500.00 |
|
MR202556 | Nudt14 (Myc-DDK-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 14 (Nudt14) |
USD 300.00 |
|
MR202556L3 | Lenti ORF clone of Nudt14 (Myc-DDK-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 14 (Nudt14) |
USD 600.00 |
|
MR202556L4 | Lenti ORF clone of Nudt14 (mGFP-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 14 (Nudt14) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review