Blvrb (NM_144923) Mouse Untagged Clone

CAT#: MC201501

Blvrb (untagged) - Mouse biliverdin reductase B (flavin reductase (NADPH)) (Blvrb), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Blvrb
• Synonyms: MGC11726; MGC27866
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC027279 sequence for NM_144923
  GGTGAGGCGGAGAGTGGAACCTTGTCTGGTCCCGCCCCCTCCTTCTGGGTCGAGGAGGACCCGCAGCGCG CCTCCTCGCAGCCACTGTGTTCCCGCGCGTCCTCAGAGTTCTCAGCTTTTCCGGCCCTGGACCCCGCAGC ATGACTGTCAAGAAGATCGCGATCTTCGGTGCCACCGGCAGGACCGGGCTCACCACACTGGCGCAGGCGG TGCAAGCAGGTTATGAGGTGACGGTGCTGGTTCGAGACTCCAGCAGGCTGCCATCAGAAGGACCCCAGCC AGCCCATGTGGTGGTGGGAGATGTTCGGCAGGCGGCCGATGTGGACAAGACTGTGGCTGGGCAGGAAGCT GTCATCGTGCTACTGGGCACTGGCAACGACCTCAGTCCCACTACAGTAATGTCCGAGGGCACCCGGAACA TCGTGACAGCCATGAAGGCACATGGAGTGGACAAGGTCGTGGCCTGCACCTCGGCCTTCCTACTATGGGA CCCGACCAAGGTGCCCCCACGCCTGCAGGACGTGACCGATGACCACATCCGGATGCATAAGATTCTGCAA GAGTCAGGGCTGAAATACGTGGCAGTGATGCCCCCACACATAGGAGACCAACCACTAACTGGGGCCTACA CGGTGACCCTGGATGGACGAGGGCCCTCGAGGGTCATATCCAAGCATGACCTGGGCCACTTCATGCTACG GTGCCTCACCACCAATGAGTATGACGGACACACCACCTACCCCTCCCACCAGTATGATTAGCACCCTGAC CTAGGTGGGGAGGGTCACGCATCCTAAGAAATGACACAAATAGAGGGGTCAATAAATTTTTAGCCAAGAG TTTCAAATTCTTTCAGGAAGCCTAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_144923
• Insert Size: 621 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC027279, AAH27279
• RefSeq Size: 878 bp
• RefSeq ORF: 621 bp
• Locus ID: 233016
• UniProt ID: Q923D2
• Cytogenetics: 7 A3
• Gene Summary: Broad specificity oxidoreductase that catalyzes the NADPH-dependent reduction of a variety of flavins, such as riboflavin, FAD or FMN, biliverdins, methemoglobin and PQQ (pyrroloquinoline quinone). Contributes to heme catabolism and metabolizes linear tetrapyrroles. Can also reduce the complexed Fe(3+) iron to Fe(2+) in the presence of FMN and NADPH. In the liver, converts biliverdin to bilirubin.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.