Zfp617 (NM_133358) Mouse Untagged Clone

CAT#: MC201487

Zfp617 (untagged) - Mouse zinc finger protein 617 (Zfp617), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Zfp617 (NM_133358) Mouse Untagged Clone
Symbol Zfp617
Synonyms Zfps11-6
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC014712 sequence for NM_133358
GAGTGCCTGTTCCGGAGCCTCTGTGGAGCCGCGGCAGGCCTGGGCACAGACATGGAGTCAGTGACTTTTG AGGATGTGGCTGTGAACTTCACCCTGGAGGAGTGGACTTTGCTGAATCCTTCACAGGAAAATCTTTACAG AGCGGTGATGAGAGAAACCATCAGGAACCTGCATGATATAGGACAGAAATTGGGAGAACAGAACACTGAA AATGCATACAAAAATCCTGGGGGAAATCTAAGATACCAAGTGGTAGAGAAGCTTTGTGAGTATGAAGAAG ATAGTCAATGGGAAGAAATCTTCAGTGAGATTCCAGATCCTGTGGTGAGCCAGAAAACTGGAGAAAAGCC CTGTGAAAGCCATGTGTATGGAGAAGATATCACTGGTCATTCATCTCTAAATGTGTCCCTCAGAGGTCAG ACTAGATGCAAAACACATGAGTATAAAGAACACGGAGAGAAGCCATGTAAATGTAAAGACAGTGGAGTGG CTTTTGGTTCTCCCCAGAGCTTTCTGAAGCATGAACAAATTTACACACAAGAGAAACCCTATGCCTGTAA ACAGTGTGACAAAGCCTTTAAGTATCTCAGTTCTCTTCAAAATCATAAAAGGATCCATAATAGAGAAAGA AACCATGCGTGTAAACAATGTGGGAAATCTTTTAAGAGACAGAGTAATGTTCAAGCCCATGAGAGAAATC ACACTGGAGAGAAACCCTATGTGTGTAAGCACTGTGGGAAAGCCTATACTTCCTACAGTACCCTTCGAGC ACATGAAAGAAGTCACACAGGAGAGAAACCCTATGTGTGTAAGCATTGTGGGAAAGCCTATACTTCCTAC AGTACCCTTCGAGCACATGAAAGAAGTCACACAGGAGAGAAACCCTATGTGTGTAAGCATTGTGGGAAAG CCTATACTACCTACAATACCCTTCGAGCACATGAAAGAAGTCACACAGGAGAGAAACCCTATGTGTGTAA GCATTGTGGGAAAGCCTATACTTCCTACAGTACCCTTCGAGCACATGAAAGAAGTCACACAGGAGAGAAA CCCTATGTGTGTAAGCATTGTGGGAAAGCATTCACTCAATCTAGCTACCTTCGAATACATAAAAGAACTC ACACAGGAGAGAAACCCTACATCTGTAAGCAATGTGGGAAAGCCTTTGCTCGTTCTAGCCACCTGCAAAT ACATAAAAGAAGTCATACAGGAGAAAAACCCTATGTATGTAAGCAGTGTGGGAAAGCCTTTGCTCAATCC AGTTACCTTCACATACATCAAAGAAGTCACACTGGAGAGAAACCTTACGTATGTAAGCAGTGTGGGAAAG CCTTCACTCGTTCTAGCCACCTGCAAATACATAAAATAACTCATACTGGAGAGAAACCCTACTCATGTAA GCTTTGTGGGAAAGCCTTTACTCATTCTAATTACCTTCAGATACATAAAAGAATTCACACAGGAGAAAAA CCTTATGTGTGTAAGGAGTGTGGGAAAGCCTTTGCTCGTTCCACTTCCCTTCACATACATGAAGGAACTC ACAGTGGAGAGAAACCTTATGTATGCAAGCAATGTGGGAAAGCCTTCACTTTGTCCAGTTCTCTTCGAAG GCATGATGTAGTTCATTCAGAAGAGAAACCCTATATTTGTAAGTGTTGTGGGAAAACCTTTGGTTGTTAC AGTAGCGTTCAGAAACATGAAAAGACTCATAGAGAAAACAGACTCTGTTAGTGTAATAAATATGGGGAAA CTTAGTTGCTCTGATTCTTTTCAAATACATGACATAGCTGACACTGGAAAGAAACCCAAGGTTTGTATCC ATTATGGGATGCTTTCATTGACCTTAGTTCTTTTTAATACCATGGAAGGATTCACACTGGAGAAAAACTT CTGGATATAATACAGAAAAATGTTCATTTATTCCGCTTCTTTAACAAACATGGAAAAACTTACACTGGAG AGAAATCCTAAATATAAAATGTGGAAACCCTTCATTATCACTTGACCGTCTAAAATTCATGAAAATGTGT AATCCATAGCATGAAGAAGTATTTTCGATCCATTTGCAAATGCAAGATAACAGTATGGAAGCCGGGCGTG GTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCT GGTCCACAAAGTGAGTTCCAGGACAGCCAGGACTATACAGAGAAACCCTGTCTTAAAAAAAAAAAAAAAA AAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_133358
ORF Size 1680 bp
Insert Size 1680
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC014712, NP_579936
RefSeq Size 2243
RefSeq ORF 1680
Locus ID 170938
Cytogenetics 8|8 B3.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.