OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Macrod2 (NM_028387) Mouse Untagged Clone

Be the first to review this product
SKU
MC201418
Macrod2 (untagged) - Mouse MACRO domain containing 2 (Macrod2), transcript variant 2, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Macrod2 or NM_028387"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Macrod2
Synonyms 1110033L15Rik; 2610107G07Rik; 2900006F19Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC038317 sequence for NM_028387
CGAGGGAGGAGGGCGGCGACGGGCCAGCGGCTAGCGGCGCGGGACGCAGAGCCTTTGCACTTTTCCCTCC CGAGTGTCCCCTCCATCCACCCCCCACACTCCACACACCCTGTTTGCCCGTGAGCCTGGGGAACTTGCAG CTTAAAGCCAGCCACCCCCACGGCAGCATGTACCCCAGCAACAAGAAGAAAAAGGTGTGGAGAGAGGAGA AAGAACGTTTGCTGAAGATGACCTTAGAGGAGAGACGCAAAGAATACATAAGGGACTATGTTTCTCTGAG CACCATTCTATCATGGAAGGAAGAGATGAAGAGCAAAGGCCAAAATGATGGATGCATCCCTAATGGTTGG AGAAATGGTGGAGAATGTCATGGGAGAGAGCACCTGCAGATCCTTGCCTGAGACGGTTATGGAAAGAAAG TCTTACAGCTTGGGCAATAGGAAAAGAGGCCCTTTATCTGATCTTGTTTTCCAGTCCATTTTGAATCAAG AAAGACTCATTGAAGACTCCTTGAGAAGAGTCTGTTTTGAAGAAGAAAAACAGACAAAAAAGGGTGGGCG AGAGAGTGAACTTCCTGAAGGCAAACAGACAAGAAGGGTGGGAGACACATGCAGTTTTGTTGCGTGTCTA ACTAACACTGACCTTCCTGGAGTCAACATTGAGAACTGAGAAGGTATTAAACTTAAAAATGACTGAATTT TGTGAGTTTTAAAGAAAAATGCAGGTCTTCTAGTGTGGACAGGCAACTGGACTTCAGATCTCAGACTATG TCTCTCTACTGGCTGTAGCCATCAGTCTTAAACATCCAGCGCAGTACTTTGCCTTCATGAATGGTGGCAG CTGACTATCTTTTCAGCAAAGCTTCCAAGATGAATAAAATAGTGTCTGCCAAAACCTAAAACATACAGTC TGTGTGTTTATCACTAGACCTTTGTAATGTATTTCTCTTGCATTTAAAAATTTTATGGTGCTTAACCTTA ATTGTGATTTTTTTGTCAATAAATAACTTTTCAAAAGAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI |
ACCN NM_028387
Insert Size 345 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC038317, AAH38317
RefSeq Size 1035 bp
RefSeq ORF 345 bp
Locus ID 72899
Cytogenetics 2 F3-G1
Summary Removes ADP-ribose from asparatate and glutamate residues in proteins bearing a single ADP-ribose moiety. Inactive towards proteins bearing poly-ADP-ribose. Deacetylates O-acetyl-ADP ribose, a signaling molecule generated by the deacetylation of acetylated lysine residues in histones and other proteins.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_028387" in other vectors (4)
SKU Description Size Price
MG200464 Macrod2 (tGFP-tagged) - Mouse RIKEN cDNA 2900006F19 gene (2900006F19Rik) 10 ug
$350.00
MR200464 Macrod2 (Myc-DDK-tagged) - Mouse MACRO domain containing 2 (Macrod2), transcript variant 2 10 ug
$289.00
MR200464L3 Lenti ORF clone of Macrod2 (Myc-DDK-tagged) - Mouse MACRO domain containing 2 (Macrod2), transcript variant 2 10 ug
$450.00
MR200464L4 Lenti ORF clone of Macrod2 (mGFP-tagged) - Mouse MACRO domain containing 2 (Macrod2), transcript variant 2 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products