Mrap (NM_029844) Mouse Untagged Clone

CAT#: MC201397

Mrap (untagged) - Mouse melanocortin 2 receptor accessory protein (Mrap), (10ug)


  "NM_029844" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Mrap"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Mrap
Synonyms 1110025G12Rik; C21ORF61; Falp; ORF61
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027543 sequence for NM_029844
CTGATAGAAATTAGTTAAGCAATCTTGTCTCTGGGGCTCACGGCCCAGCTGTGGGTGCGAGCCTCTGACA GACACTGTCGTCAAAGCCACAGTCATGGCCAACGGGACCGACGCCTCTGTCCCGCTCACCAGCTATGAGT ATTACCTGGACTACATAGACCTCATTCCTGTGGACGAGAAGAAGCTGAAAGCCAACAAGCATTCCATTGT CATCGCCCTGTGGTTGAGCCTGGCTACCTTCGTGGTGCTCCTCTTTCTCATCCTGCTCTACATGTCCTGG TCGGGCTCCCCACAGATGAGGCACAGTCCCCAACCCCAGCCAATATGTTCATGGACTCACAGCTTCAACC TCCCTCTGTGCCTCCGGAGGGCCTCCCTGCAGACAACAGAGGAGCCAGGAAGGAGAGCTGGCACTGACCA GTGGTTAACGCAGCAGAGTCCTTCTGCCTCAGCCCCGGGGCCCCTGGCTCTCCCCTAGGACCAGGTCCAG GATGGAGGTCCCAGGGCATCAGCTGGCCTCACACTCAAGCAGTGGTGAGCCTGGAGACAGAGCGTCTCAA CTGTAGAACGGATGATGCCAGAGAGCCAGTCGGGCTCAAGCAAACGGTGAACTCCAACCAACCCGGGCAG CTACGTCTTTTTTAGGGCCGTTTACAATGGCCTTGAATATAGCAGGAAACTGACCGGGACAAAACCAAGT TTACAAAGAGGACCATCACACACATTGATAGTGCAGCTAGGATGCAGGAGCTGCCCTGGACACAGCTGTC TCTGTTGAGCAAGCTTAGCCTGCTTGCTGCTTACATTTGCTTTGGGGGTACACAGGAAAATAAAATGTGA ATTAGGATAAAGAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_029844
Insert Size 384 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC027543, AAH27543
RefSeq Size 874 bp
RefSeq ORF 384 bp
Locus ID 77037
UniProt ID Q9D159
Cytogenetics 16 C3.3
Gene Summary Modulator of melanocortin receptors (MC1R, MC2R, MC3R, MC4R and MC5R). Acts by increasing ligand-sensitivity of melanocortin receptors and enhancing generation of cAMP by the receptors. Required both for MC2R trafficking to the cell surface of adrenal cells and for signaling in response to corticotropin (ACTH). May be involved in the intracellular trafficking pathways in adipocyte cells (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.