Borcs7 (NM_025563) Mouse Untagged Clone
CAT#: MC201380
2010012O05Rik (untagged) - Mouse RIKEN cDNA 2010012O05 gene (2010012O05Rik), (10ug)
"NM_025563" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Borcs7 |
Synonyms | 2010012O05Rik; 4930569L17Rik; AI413851; AI467257 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC027506 sequence for NM_025563
CGCTAGTTGAGGTGATGGCGACTGGGACGCCGGATTCGCAAGCCCGATTTGGTCAGTCCGTGAAGGGGCT TCTCACGGAGAAGGTGAACACCTGTGGCACCGATGTAATCGCGCTCACCAAGCAGGTGCTGAAAGGCTCG CGGAGCTCCGAGCTGCTGGGGCAGGCAGCTCGAAACATGGTACTACAGGAAGATGCCATCTTACACTCGG AAGATAGTTTAAGGAAGATGGCAATAATAACAACACACCTTCAGTACCAGCAAGAAGCTATTCAGAAGAA TGTGGAACAGTCGCCTGACCTGCAGGACCAGTTGAGTCACTTACTGAAGTAGCACATCAGATGCTAAGGA GGGCCTGTCCTACACAACCATCAGGCCGTGGCCTTGGTCTCCATCTTCATCTCCAGAGAATCATCTAGAA AAGACTTGTGAAGCCAGGCGTGGTGGTGCACACCTTTAATCCCAGCTTTTCTGAGTTCAAGGCCAGCCTG GTCTACAGAGTGAGTTCCAGGACAGCCAGAGCTACAAAAAAAAAAAAAAAAAAAAAAAAAAAGACTCGTG AAAAGAAGAAGCCAAGTGACTGAGCATGGAAGCAGTTCTTAAATTGATGAACTCATCTTCAAGTTGGTTT ATATTGAAATAAATAGGTTGAATCATTAGCACTAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_025563 |
Insert Size | 318 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC027506, AAH27506 |
RefSeq Size | 683 bp |
RefSeq ORF | 318 bp |
Locus ID | 66439 |
UniProt ID | Q9CRC6 |
Cytogenetics | 19 C3 |
Gene Summary | As part of the BORC complex may play a role in lysosomes movement and localization at the cell periphery. Associated with the cytosolic face of lysosomes, the BORC complex may recruit ARL8B and couple lysosomes to microtubule plus-end-directed kinesin motor.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200354 | 2010012O05Rik (tGFP-tagged) - Mouse RIKEN cDNA 2010012O05 gene (2010012O05Rik) |
USD 350.00 |
|
MR200354 | 2010012O05Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 2010012O05 gene (2010012O05Rik) |
USD 150.00 |
|
MR200354L3 | Lenti ORF clone of 2010012O05Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 2010012O05 gene (2010012O05Rik) |
USD 450.00 |
|
MR200354L4 | Lenti ORF clone of 2010012O05Rik (mGFP-tagged) - Mouse RIKEN cDNA 2010012O05 gene (2010012O05Rik) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review