Sprr1a (NM_009264) Mouse Untagged Clone
CAT#: MC201375
Sprr1a (untagged) - Mouse small proline-rich protein 1A (Sprr1a), (10ug)
"NM_009264" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Sprr1a |
Synonyms | AI528815; mSPRR1A; SPR1a |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC027534 sequence for NM_009264
CAACAGAGAACCTGCTCTTCTCTGAGTATTAGGACCAAGTGCTATCTAACCATGAGTTCCCACCAGCAGA AGCAGCCCTGCACTGTACCTCCTCAGCTGCACCAGCAGCAGGTGAAGCAGCCTTGCCAGCCACCACCCCA GGAACCTTGTGCCCCCAAAACCAAGGATCCCTGCCACCCTGTTCCTGAGCCCTGCAACCCCAAGGGGCCA GAGCCCTGCCACCCCAAGGCACCCGAGCCCTGCCACCCCAAGGCACCTGAGCCCTGCAACCCCAAGGTGC CAGAGCCCTGCCAGCCTAAGGTGCCAGAGCCCTGCCAGCCTAAGGTGCCAGAGCCCTGCAACCCCAAGGT GCCAGAGCCCTGCCAACCTAAGGCACCAGAGCCTTGCCACCCCAAGGCGCCTGAGCCCTGCCACCCTGTT GTTCCCGAGCCCTGCCCCTCAACTGTCACTCCATCACCATACCAGCAGAAGACAAAGCAGAAGTAATATT GTCCAGAGCCATGCCTGAAGACCTGATCACCAGATGCTGAGGCTGCTGTCTATCCTGCTTATGAGTCCCA TTGCCTTGTGCTACCAATGCTGTGACCTTCAATCTTAATCCCTCTCTCCTTGCACCACCTAAAAAGTTGA CTCTCATCCTCATCTTCAAGGGCTCCTGAGCCTCTTAACATTGCCCAAAGTCATATTGAATGGCTACACT TTTCATGGCTCAGGATTCATCTGAAGGGGGTGAGGAGTGAGACAAGTGTATGGTCAATATTTTCCCCCCA TTAAATGCCATTTAACTCCAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_009264 |
Insert Size | 435 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC027534, AAH27534 |
RefSeq Size | 807 bp |
RefSeq ORF | 435 bp |
Locus ID | 20753 |
UniProt ID | Q62266 |
Cytogenetics | 3 40.14 cM |
Gene Summary | Cross-linked envelope protein of keratinocytes. It is a keratinocyte protein that first appears in the cell cytosol, but ultimately becomes cross-linked to membrane proteins by transglutaminase. All that results in the formation of an insoluble envelope beneath the plasma membrane. May participate widely in the construction of cell envelopes in cornifying epithelia characterized by either increased thickness or a requirement for extreme flexibility.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200942 | Sprr1a (tGFP-tagged) - Mouse small proline-rich protein 1A (Sprr1a) |
USD 425.00 |
|
MR200942 | Sprr1a (Myc-DDK-tagged) - Mouse small proline-rich protein 1A (Sprr1a) |
USD 225.00 |
|
MR200942L3 | Lenti ORF clone of Sprr1a (Myc-DDK-tagged) - Mouse small proline-rich protein 1A (Sprr1a) |
USD 525.00 |
|
MR200942L4 | Lenti ORF clone of Sprr1a (mGFP-tagged) - Mouse small proline-rich protein 1A (Sprr1a) |
USD 525.00 |
{0} Product Review(s)
Be the first one to submit a review