Fuom (NM_026928) Mouse Untagged Clone

CAT#: MC201372

Fuom (untagged) - Mouse RIKEN cDNA 1810014F10 gene (1810014F10Rik), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fuom
• Synonyms: Fucu; Le51
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC028662 sequence for NM_026928
  ATCCTGCGGCCATGGTTGCGCTCAAGGGCATCCCGAAGGTGCTGTCTCCTGAGCTGTTGTTCGCGCTTGC GCGGATGGGGCATGGAGACGAAATTGTCCTTGCTGATGCGAACTTCCCTACCTCCTCCATCTGCCAGTGC GGACCTGTGGAGATCCGAGCAGACGGCCTGGACATCCCACAGCTTCTGGAGGCTGTGCTGAGGCTCCTGC CCCTGGACACCTACGTGGAAAGCCCGGCTGCTGTCATGGACCTGGTGCCCAGTGACAAGGAGAAGGGCCT GCAGACCCCGATATGGAAGCGTTATGAATCCCTTCTTCTCGAAGCTGACTGTAAAAAAACCCTGATGAAG CTAGAGAGATTTGAATTTTATGAACGTGCAAAAAAGGCATTTGCTGTGGTTGCAACCGGGGAGATGGCAC TCTATGGAAACATCATCCTCAAGAAGGGAACTCTTGACCTCGGACCCTCATAGAGACCACCTTCCCTTGG CAGCAACCAGACCTGGACATCAGCCTCGGGCTCAAGAAGATGGCAGATCTTGAGAGACTCTGCTGACCCT GACAAATTCCCCCTTCCATGACTTGTGAGATTGATCGGGGAGGGAGTCATTGTCAAGCTTTAATCTAAAG GTTTTGTAGTCATGAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: EcoRI-NotI
• ACCN: NM_026928
• Insert Size: 462 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC028662, AAH28662
• RefSeq Size: 668 bp
• RefSeq ORF: 462 bp
• Locus ID: 69064
• UniProt ID: Q8R2K1
• Cytogenetics: 7 F4
• Gene Summary: Involved in the interconversion between alpha- and beta-L-fucoses. L-Fucose (6-deoxy-L-galactose) exists as alpha-L-fucose (29.5%) and beta-L-fucose (70.5%), the beta-form is metabolized through the salvage pathway. GDP-L-fucose formed either by the de novo or salvage pathways is transported into the endoplasmic reticulum, where it serves as a substrate for N- and O-glycosylations by fucosyltransferases. Fucosylated structures expressed on cell surfaces or secreted in biological fluids are believed to play a critical role in cell-cell adhesion and recognition processes.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.