Coa3 (NM_026618) Mouse Untagged Clone

CAT#: MC201347

Coa3 (untagged) - Mouse coiled-coil domain containing 56 (Ccdc56), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Coa3 (NM_026618) Mouse Untagged Clone
Symbol Coa3
Synonyms 1810033A19Rik; Ccdc56; D11Ertd99e; HSPC009
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC026206 sequence for NM_026618
GGGCGGAGCAGCAACATGGCGGCCCCTGGAGCTGGTGACCCTCTGAATGCTAAGAATGGAAATGCTCCAT TCGCTCAGCGCATCGACCCGTCGCGGGAGAAATTGACCCCAGCGCAGTTGCAGTTTATGCGGCAGGTGCA ACTTGCCCAGTGGCAGAAAACACTGCCACAGCGGCGGACCCGGAACATCATGACCGGCCTGGGCATCGGG GCCCTGGTGTTAGCTATTTATGGTTACACCTTCTACTCGGTGGCCCAAGAGCGTTTCCTTGATGAGCTGG AAGATGAAGCCAAAGCTGCCCGAGCCCGTGCTCTTGAGAGAGAGCGAGCTTCGGGACCCTAACTGTATGG ACCATCTTCAAACTGCTGGATCCCCTGTATATGTTGAATGATGCCTGGTGGTCTTACAGCATCACTGGCA CACTAACGTCGGACTGTGTGATTGAGCCCAAGAAGCCAGAGACTATGCATTTGGCCGCTGCCAAGGGGGG GATTGCTCACTTCACGTGCAGTTTGTCCAGTTACTCAGCCCTTTTTATTTCCTTGTTTGAGAGGTATGCA ACCTTGCCTTTACCCAAACTTTGTGGTTTACCCCTTCACCTCCCAGGGGCCCCGACTCTTAAGGGGGAGG GTGTGGCTTAACTGCAGCGTTGGAACCTTAAAGTGGGAAAGATAGGGTCAAGTTAAAGTAATAAAATGAG TCATGTCTCCCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
Tag Tag Free
ACCN NM_026618
ORF Size 327 bp
Insert Size 327
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC026206, NP_080894
RefSeq Size 744
RefSeq ORF 327
Locus ID 52469
Cytogenetics 11 D|11 64.56 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.