Slc52a2 (NM_029643) Mouse Untagged Clone

CAT#: MC201310

Slc52a2 (untagged) - Mouse G protein-coupled receptor 172B (Gpr172b), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Slc52a2 (NM_029643) Mouse Untagged Clone
Symbol Slc52a2
Synonyms 2010003P03Rik; D15Ertd747e; GPCR42; Gpr172b; mRFT1; PAR2
Vector pCMV6-Kan/Neo
Sequence Data
>BC016264 sequence for NM_029643
CTGCCTTCCGGGCTAAGTGGCGTGCTCCCGGGGCTGGGCGGGCTGCTCCGGCCCCACGCCCCTGATGCAC CGCACTCAGCCGAGGAGCCCAGAATCGAATCAAGTCAGCCAGCCACACCTCTTGCCGATCCACGCCGGCT GCCTGAAGTTAGCTGTCATCCAGTCTGGTTTAGCCGCGCCAAGACTTGGTCCTCCGCAAGCATCAAGGAC TGGCTCTTTCGCTCATCTTCCTCCCCGGAACCATGCTTTAAGCCAGCTTCTCGCTCCCCCGCTTGCCAGT CTTGTACAGAAGGGTCCCGGTGCAGGCTCCATGAATAGTTAGAGAAGCTTTGGATCTACGTGGGAAAAGG GCGGACTGTTACCTTCGCTTTGTCCTGGAGGGCCCGCTTTGACCTTTGACCTAATGGCAGCACCTCCGCT GGGCCGACTGGTGCTGACCCATCTGCTGGTGGCCCTTTTCGGCATGGGCTCCTGGGCTGCTGTCAACGGG ATCTGGGTAGAGCTGCCGGTAGTGGTGAAAGAGCTCCCGGAGGGTTGGAGCCTCCCTTCCTACCTCTCTG TGCTTGTGGCGCTGGGAAACCTGGGTCTGCTGCTGGTGACTCTGTGGAGGCGTCTGGCTCGCGGCAAGGG CGAGCAAGTCCCCATCCGAGTGGTTCAGGGGCTAGGCATAGTGGGCACAGGCCTACTGGCCTCTCTGTGG AACCACGTGGCCCCAGTGGCAGGAAAGCCGTACTCAGTGGCCTTCCTAACGCTGGCGTTTGTGCTGGCAT TGGCCTGCTGTGCTTCTAATGTCACTTTCCTGCCCTTCTTGAGCCACCTCCCACCCCCCTTTTTACGGTC TTTCTTCCTGGGTCAGGGCCTGAGTGCCCTCCTGCCCTGTGTGCTAGCCCTGGGTCAAGGGGTGGGCCGC CTTGAGTGCCTGCATGTGCCTGCCAACAGGACCACTGGGCCTCCGATCGAGGTGTCTCCCATTAATTTCC CTGAACGGTTTTCTGCCACCACGTTCTTCTGGGTGTTGACTGCCCTTCTGGGCACTTCAGCAGCTGCCTT CCAAGGCCTCCTGTTACTACTGCCATCCCCGACATCTGAACCCACAACAGGTACAGGGCTTCGGGTAGAA ACACCAGGAACAGAGGAGGAAGAGGAAGAGGAAGAGGCCTCACCTTTGCAGGAGCCACCAGGCCAGGTGG CAGGCATTGTTTCCAGCCCAGACCCTAAGGCCCATCAGCTGTTCTCTTCCCGAAGTGCCTGTCTACTGGG CCTGCTGGCCATCACCAATGCTCTGACCAATGGCGTGCTGCCCGCTGTACAGAGCTTTTCCTGCCTGCCC TATGGGCGCCTGGCCTACCACTTGGCTGTCGTACTGGGTAGCTGTGCCAACCCCCTTGCCTGCTTTCTGG CCATGGCAGTGCTGTGCAGGTCTCTGGCAGGGCTGTGTGGTCTGTCTCTGCTGGGCATGCTCTTGGGCTC CTACCTGATGACACTGGCAGCCTTAAGTCCCTGTCCTCCTCTGGTGGGCACCTCTGCAGGTGTGGTCCTC GTGGTACTCTCATGGGTCCTGTGCGCAGGCACGTTCTCGTATATCAAGGTGGCGATCAGTTCCATGTTAC ACAGCGGAGGCCGGCCAGCACTGCTCGCTGCTGGCGTGGCTATTCAGGTGGGCTCTCTGCTGGGTGCGGT CGCCATGTTCCCTCCTACCAGCATCTACCGAGTATTTCGCAGCGGAAAGGACTGTGTGGACCAGTGTGGC CTCTGAACCCAGACGTGTAGGAGTTACTTCACACTTGTCTCCACCTGGAGGGTAGGAGGGATGGTCACAG TGCCTGGGTCCTGTGGCCCAAGGTGGCCACCCTACACACAGATAATATGGATATTTCACACTCCACAAGA GACCTGGCTTTGGAGAAAAGACCAGTGTGAGGACCAAAGAGCAGGCCCAGACCCAGGGATAGATTGGAGC TGCGCGGCCTTCACCCCTGGGACCTCTGTGGGATTTGCACAATAAAACATCTTCATCCAAAAAAAAAAAA AAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_029643
ORF Size 1353 bp
Insert Size 1353
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC016264, NP_083919
RefSeq Size 2042
RefSeq ORF 1353
Locus ID 52710
Cytogenetics 15 D3|15 36.04 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.