Pbld1 (NM_026701) Mouse Untagged Clone

CAT#: MC201288

Reviews ()
Write a review

Pbld1 (untagged) - Mouse phenazine biosynthesis-like protein domain containing 1 (Pbld1), (10ug)

  View "NM_026701" in other vectors (6)

Reward yourself with an Amazon® Card when get any 3 cDNA clones.

USD 200.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Pbld1 (NM_026701) Mouse Untagged Clone
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pbld1
Synonyms 0610038K03Rik; Mawbp; Pbld
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>BC019997 sequence for NM_026701
AATGAAGCTCCCAATCTTCATAGCAGATGCGTTCACTGCGACAGCTTTCCGGGGCAATCCTGCCGCAGTC TGCCTCCTGGAGCGCACATTGGAGGAAGACGCCCATCAGCAAATTGCGAGGGAGATGAACCTCTCAGAAA CGGCTTTCATCAGGAAACTGCAGCCGACTGACAGCTTCACACAAAGCTCTCGCTTTGGACTGAGATGGTT TACGCCAGTGAGTGAAGTCCCCTTGTGCGGCCACGCCACACTGGCCTCTGCGGCTGTGCTGTTTCACAAA ATACAGAACAGGAACAGCACCCTGACCTTTGTCACAATGAGCGGGGAGCTAAAGGCCAGAAGAGCAGAAG ATGGGATAGTCCTGGACTTTCCTGTCTACCCAACCTTTCCCCAGGACTTCCATGAAGTTGAAGACTTGAT AAAGGCAGCCATAGGTGACACCCTGGTCCAGGACATCCGGTACTCTACAGATACCAGAAAACTCCTGGTC CGGCTCAGCGATTCTTATGACAGGTCCTTTCTAGAGAGCCTGAAGGTGAACACAGAGCCTCTGCCTGCAA TTGAGAAGACAGGGAAGGTGAGAGGCCTCATCCTCACTGTCAAAGGAGAGCCTGGGGGGCAGACGGCCCC GTATGACTTCTACTCCAGATACTTCGCGCCGTGGGTTGGTATTGCTGAAGACCCGGTGACAGGATCTGCA CACACCGTTCTCAGCAGTTACTGGTCCCAGCAGCTCAGGAAGAAAGAGATGCGAGCCTTTCAGTGTTCCC GCCGAGGAGGGGAGCTGGACATTTCCCTGCGACCTGATGGGCGCGTTGACATAAAGGGCGGAGCTGTTAT TGTCTTGGAGGGCACGCTGACCGCCTAGAGATGCTCCTGCTGGGCTTGGGGCCACTGTTCCACAAGTGTC TTCTCTAGAGCCCAGAACCCGACCCAACCCAACTCAACAGCAGATGCACAGAGCTTGGTTCAGTCGTCGT GTGAACCCAAAAGGGAAGACACCTGATGGAGGTGCGGTAGTGTCTCCAGAATCCTTTCCCGATGGTGGGC TCTGAACTCTGCCTGTGTGTGCATCTTCAGTCCCCACAGCAGATAGGGATGCTGCCCCTTCTTTTGATCA TGACTGCCAATCAAAGTGAGAGGTGCACTGATAAGGAGCCAGAGAATGCCATTTCAATTGAGGTATGGGT ACCTTAGGGCATTTCACAGCCCTTTAGAAGAATAAATAGGTGTGTAGAATGTTGTGTTGCCAAAAAACAT TTTCTCTCCGCCCCCTAAGGTTCCAAAGACCAACCAAGGCACACCACCACCAAAGCTCCCCTAGGGCACC AATGAGTTATCAGACTTCTTTACAGAGCAGAGGTGAAGGTTTCCTTACAGCGGTGTGGGTTCCATCCCCT AAAATGTGGCACCAGAAGGGCTTTTACATAGCATCAATGGTGACCTTCCTATAGTGGCACAGATGGAGCC CAGCTCCCCTAATCTCTGCTGGCCTGTGTCCTCCAGCCTCTTTGAGGCCATGTGCAATTAGGGCAATGTT GCATACATAGGAGGTAGTGAGTGGCTGGGTTCTCAGAGGAGGCCCCGTGATCTCCCCATCCCTCTATGAG GAGATGTAAACAGTCGCCAGACCCAGCTGGCATGATCTTTGGCAAGTGCGCACAGCTGAACTCCTGAAGA TGGAAGTTGCTTGGCTCAGGGTATGGTCCTGAGCAACATGCAAAAGTCCATCTCCTGATGTAATAATACT AGGAAAGATGAGGGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCGA AGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACATGATCTGACTCCCTCTTCTGGAG TGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTTAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_026701
ORF Size 867 bp
Insert Size 867
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC019997, AAH19997
RefSeq Size 1956
RefSeq ORF 867
Locus ID 68371
Cytogenetics 10 B4

Other Versions

Other products for "Pbld1"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
BOGO Free lysates
68 Mouse Clones