Cenpq (NM_031863) Mouse Untagged Clone

CAT#: MC201216

Cenpq (untagged) - Mouse centromere protein Q (Cenpq), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cenpq (NM_031863) Mouse Untagged Clone
Symbol Cenpq
Synonyms 2610528M18Rik
Vector pCMV6-Kan/Neo
Sequence Data
>BC018524 sequence for NM_031863
CAGAAGCGCGCCTTTTAAATCCGTGAAGCAACAGTGAAGAGTCGAGGAAGCGATAAAGCGGCTGACAGAT CCAGGGGATAATTTGAGCCTCACGCGTTTGTGACTATGTATCGTTGTGATTATACTGTTTAGATGGAAAT AGCTGGTAAAGCACGTGCTTCTAGGAAAAAACCTCAACAGGTGAAAAGAAGTTTGAAACAAAGAGCCAAT AAGGAAGCGGATTTGCCAGAGAATGAGGTTGGAAACACAGCAAAAAGAAACAGAAGTCATGCAAAGCATC TGTCCTCTAAAGTAACAGGACAAGCAACGTATGTTCATCTAAAACGGGTAAAAATATCATCCAGCAAGAG AACAACCTGGCAACCTCTTCCAAAGGATACTGAAGAGTATTTGCAAAGTATGATGGAGTCAGTCATTCTT GGAATTTTATTCAACATAAAAAGAAAAGAACAAATTCAGTGTCATCTCAACCAGTTGAAGAAAAGACTAC TACAACAATGTGCAACACTGAAAGTCCCTCCAAGAAAGTTGAACTATTTAAAGGATGTGTCAAAAATGCT GAAAATGGAAAAGGCACAGGAAAGAGCAAATGAAGAGAGCCTGGCTTCACTGCAGGAAGAAATAGACAAA ATAGTAGAGACCACAGAGTCAATGACTGAGAGTATTCAAAGCCTAAAGAATAAAATTCAAATTTTGACAA GTGAAGTAGAAGAAGAGGAACAGGAGGTGAAACAGGTATTTCACATAGATAGCAATAAAGTACTTGCTCT TCCAGAACTTTCTCAGAAAAGTCTTAAAGCACCCATACTTCAAGAAGAAATTTTGGCACTAATTCCAAAC CAGAATGCTCTTCTGAAGGACTTGGATGTTCTTCATGATTCAGCCCCAGTGAAGAATGTGTCAGCATTCA TTGAAGAAGCCTATAAGAAACTTGACTCCTAAAGAGTTGGATTTTGTTTTGGTGTTTAAGCCGTGTTCCA TATTAACTTATTGTTGATAAATTGTAAAACTCTTTTTTCTTTTAATAATAGTCTCTCACTCTGTTTGTAG CCTAGGCTGGCTCAGCACTTACTCTTTCTCCCATTTGGCCTTGAACTCCCAGCAATCCTGCCTCAGCATC CTGAGTGCTGGGATTACCGGGGCGAGCTTCACATCTGGCCCAAAAGGTGTGCAATTTAACTGGAGATCTT TCTTCAAAACAATTAACCTTTGTTATCTACCTTAAAACTAGCCTGTGTGGGCTTATCATTAATATCTAAT GTCCTAAAAACATTACAGTTGCTAAATCTAGGAAATGTATATATATGTAGATATTTGCTAAAACTGTTTA CTGAGAATTATTTTTAAAAATAAAAAAAAAATGCCATGATGTAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_031863
ORF Size 810 bp
Insert Size 810
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC018524, NP_114069
RefSeq Size 1387
RefSeq ORF 810
Locus ID 83815
Cytogenetics 17|17 B2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.